Primer design
Babesia motasi specific primers for CPA were designed using the sequence alignments of the 18S rRNA gene of Babesia spp. and Theileria spp. infective for sheep and humans (Table 1). A region that is conserved intra-B. motasi and variable among species was used as the target sequence for primer location. Two sets of primers and probes were designed using the Primer Premier 5.0 software (Premier Biosoft International, Palo Alto, CA); each set of primers and probes was composed of two displacement primers (BLT-5s and BLT-4a), one cross primer (BLT-2s1a), and two detector primers (BLT-2s and BLT-3s). The detector primer (BLT-2s) was labeled with biotin at the 5' end and the BLT-3s was labeled with fluorescein isothiocyanate (FITC) at the 5' end. The cross primer was composed of the BLT-2s at the 5' end and 1a at the 3' end. These primers were synthesized by TsingKe Biotech Co., Ltd (Beijing, China).
Table 1. The sequences of B. motasi CPA-VF primers and probes.
|
Primer name
|
Sequence (5'-3')
|
Set one
|
BLT-5s
|
GCTAATTGTAGGGCTAATACAAG
|
|
BLT-2s
|
FITC-CGATGCCTTTTGGCGGCG
|
|
BLT-3s
|
Biotin-GCTTTTAAACCAATTGTTGG
|
|
BLT-2s1a
|
CGATGCCTTTTGGCGGCGCGATTCGCAAGTTTATTATG
|
|
BLT-4a
|
CTTGAATGGAACATCGCTAA
|
Set two
|
BLT-5s
|
GGADWWDGTCCGKTTTTG
|
|
BLT-2s
|
FITC-CTTAGAGGGACTCCTGC
|
|
BLT-3s
|
Biotin-GCTTGAAGCGTGGGGT
|
|
BLT-2s1a
|
CTTAGAGGGACTCCTGCCAGACCTGTTATTGCCTT
|
|
BLT-4a
|
CGCCTGCCGTTCGACGATT
|
Blood samples
Standard positive samples were obtained from sheep experimentally infected with B. motasi. Briefly, 16 6-month-old sheep that were divided into four groups (group 1-4) containing the same number of experimental animals were purchased from Jingtai county, Gansu Province and confirmed to be free of piroplasm infection by microscopy, RT-PCR, nPCR and ELISA assay [16, 20, 26, 27]. Group 1, 2, 3 and 4 were inoculated intravenously 10 mL of cryopreserved blood infected with B. motasi Lintan, B. motasi Tianzhu, B. motasi Ningxian and B. motasi Hebei, respectively. When the parasitemia reached 8%–10%, blood samples were collected into EDTA-coated tubes. Each of three intact sheep was inoculated with 50 ml blood infected with B. motasi Lintan/B. motasi Tianzhu/B. motasi Ningxian/B. motasi Hebei via the jugular vein. Jugular blood was collected every two days after inoculating Babesia species. Negative blood samples were collected into EDTA coated tubes from randomly selected sheep in Jintai county, Gansu province, where B. motasi is not endemic. All blood samples were transported to the VVBD laboratory, LVRI in iceboxes and stored at − 20 °C before DNA extraction.
Genomic DNA was extracted from 200 μl of above-mentioned blood samples using commercial DNA extractions kits according to the manufacturer’s instruction (QIAamp DNA Blood Mini Kit, Germany).
Optimization of the CPA-VF assay for B. motasi detection
Initially, we designed two sets of primers to develop a highly sensitive and specific method. The CPA amplification was performed in a 20 μl volume. Optimization of reaction composition led to the following: 1.25 μM each of displacement primers (BLT-5s and BLT-4a), 7.5 μM each of detector primers (BLT-2s and BLT-3s), 12.5 μM of cross primer (BLT-2s1a), 6 mM MgSO4, 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 1 M betaine, 8U Bst DNA polymerase (New England BioLabs), 8 mM deoxynucleotides triphosphates (dNTPs) , 0.1% Triton X-100, and 2 μl genomic DNA. The CPA reaction tubes were incubated at 63 °C for 60 min, followed by 80 °C for 2 min to terminate the reaction. Finally, VF strips, purchased from Hangzhou Ustar Company (Hangzhou, China), were used to detect CPA products: 5 μl of CPA products and 90 μl of PBS were added to the sample pad. A reaction was identified as positive when both the test line and the control line were developed, whereas it was considered as negative when only the control line was developed.
Furthermore, the CPA reaction were performed at different temperatures, ranging from 55 to 65°C and various time settings, ranging from 40 to 100 min. Subsequently, the amplified products were detected using VF strips.
Specificity and sensitivity of the CPA assays
Genomic DNAs of Theileria luwenshuni, T. uilenbergi, T. ovis, Babesia sp. Xinjiang and Babesia sp. Dunhuang were provided by VVBD. The specificity of the assay was evaluated using genomic DNA from B. motasi Lintan, B. motasi Tianzhu, B. motasi Ningxian, B. motasi Hebei, Babesia sp. Xinjiang, Babesia sp. Dunhuang, T. luwenshuni, T. uilenbergi, T. ovis, B. divergens, B. duncani, and plasmid DNAs bearing the 18S rRNA gene of B. microti (KF410825) and B. crassa (AY260176). To evaluate the assay’s sensitivity, serial dilutions of genomic DNA from purified B. motasi Lintan merozoites were used as the template for CPA amplification in concentrations: 4 ng/μl, 800 pg/μl, 160 pg/μl, 32 pg/μl, 6.4 pg/μl, 1.28 pg/μl, 0.256 pg/μl, 50 fg/μl, 10 fg/μl. Each concentration of genomic DNA was tested in three independent experiments to ensure reproducibility of the CPA assay.
To evaluate the performance of the CPA-VF assay, its sensitivity and specificity were determined using standard positive samples (experimentally infected animals ) and field collected negative samples, versus microscopy, RT-PCR, and nPCR targeting the 18S rRNA combined with gene sequencing [20, 26, 28].
Clinical performance of CPA-VF assay for clinical specimens
Field blood samples were randomly collected from 340 sheep in Gansu province, transported to VVBD, LVRI in iceboxes and stored at –20°C before DNA extraction. The collection and manipulation of blood samples were approved by the Animal Ethics Committee of the LVRI, Chinese Academy of Agricultural Sciences. All sampling procedures were handled in accordance with the Animal Ethics Procedures and Guidelines of the People’s Republic of China.
A total of 492 patients who lived in the Gannan Tibetan Autonomous Prefecture, Gansu Province and visited the Second Hospital of Lanzhou University for a tick bite in the past few months, between May 2017 and July 2019, were recruited. Blood samples collected from patients were tested using the CPA-VF assay to determine the infection status of B. motasi. All participants agreed to participate in this study and signed an informed consent form.
The clinical performance of the CPA-VF approach was evaluated with these field blood samples collected from sheep and clinical specimens from patients with a history of tick bite.