Isolation of SM
The dry plant E.littorale was acquired from Saurashtra region, Gujarat, India . The plant was press dried and then powdered in a crusher. The powder was immersed overnight in double the volume of 70% methanol (SRL, India) and 30% water. The process was repeated for three times for a single batch and then filtered. The filtrate was vacuum evaporated using a rotary evaporator (Heidolph Germany), to get a dry hydro-alcoholic extract.
To obtain SM from the hydro-alcoholic extract, silica based column chromatography was done. 1 g of hydro-alcoholic extract was coated with 3 g silica. The extract was chromatographed using silica gel ( 60 -120 mesh size, Merck , Germany) with hexane and then with hexane containing ethyl acetate (60-97 %), followed by ethyl acetate and then with ethyl acetate mixed with methanol in the order of increasing polarity (0.5-1.5%). Fractions with different polarities were assessed for the presence of SM by thin-layer chromatography (TLC) using the solvent system of chloroform: methanol (8:2). The presence of SM was established by co-chromatography of the standard SM (TCI, Japan) along with different fractions. Fractions with SM were pooled and dried. They were further purified by precipitating the methanol dissolved residue with non-polar solvents like diethyl ether (yield: 7%).
Characterization of the Isolated SM
The characterization as well as the purity of the isolated compound was confirmed by various methods which included TLC , HPLC, LC-MS and FTIR.
High Performance Liquid Chromatography (HPLC)
For HPLC analysis, the solution of SM isolated in the lab was prepared to achieve a final concentration of 1 mg/ml in methanol. The samples and solvents to be used as mobile phases were filtered through 0.2 µm syringe filters (Axiva, India). HPLC was carried out using the previously described mobile phase for SM with slight modifications by using acetonitrile: water (10:90) as the mobile phase [23]. The flow rate was 1 ml/min and the column temperature was maintained at 25°C. The detection wavelength and mode for SM was 238 nm and Photodiode detector (PDA).
Fourier-transform infrared spectroscopy (FTIR) and mass spectrometer (MS)
The isolated compound was analyzed by FTIR for the identification of functional groups present in the compound. The standard was also used as a reference for the isolated compound. A homogenous solution of both, standard and the compound was individually prepared in potassium bromide (KBr) and subjected to FTIR spectrophotometer (Thermofisher Scientific, USA). The compound isolated was also subjected to positive- ion Electrospray Ionization i.e. ESI using Perkin – Elmer Applied Biosystem Sciex API 2000 for identification of its characteristic molecular ion peak.
In-vitro Antiglycative Studies
Antiglycative studies were done as suggested by McPherson et al. with slight modifications [24]. Bovine Serum Albumin (BSA, Himedia, India) and Fructose (Merck, USA) were used to induce glycation. In brief, in a 1.5 ml eppendorf, 100 µl of 60 mg/ml BSA (20 mg/ml final concentration) was incubated with 100 µl of 1.5 M fructose (0.5 M final concentration) and 100 µl of potassium phosphate buffer (pH 7.4). Negative control was incorporated as well, which consisted of 100 µl of 60 mg/ml BSA (20mg/ml final concentration) and 200 µl of potassium phosphate buffer (pH 7.4). To understand the antiglycative potential of the compound, the same reaction was carried out in the presence of varying concentrations of SM (1 µg/ml to 10 µg/ml). For the comparative studies, metformin was used as a positive antiglycative control at the same concentrations as of SM. The reaction was incubated at 60°C for 24 h and samples were analyzed for fluorescence due to AGEs on a spectrofluorometer (Perkin Elmer LS-55, USA) by using an excitation wavelength of 370 nm and an emission wavelength of 440 nm.
UV Absorbance Spectroscopy
The native, glycated BSA and samples in which BSA glycated in presence of SM were analyzed for their absorption spectra on Shimadzu UV‐1700 spectrophotometer in 200 to 800 nm wavelength range using a quartz cuvette. The samples were analyzed for the hyperchromic shift due to glycation by fructose as suggested by Allarakha et al [25].
Culturing of NRK-52 E Cells
Normal Rat Kidney (NRK-52E) cell line was acquired from National Centre for Cell Sciences (NCCS), Pune, India. The cells were cultured in Dulbecco's Modified Eagle Medium Low Glucose (5.5 mM/L) medium with 10% fetal bovine serum, 1% L-glutamine, and 1% penicillin/streptomycin (Thermofisher Scientific, USA) at 37 °C in a 5% CO2 incubator. The cells were grown till 80-90% confluency, after which they were used for experiments with high glucose in the presence and absence of SM.
Cell Viability Assay
The concentration of methylgloxal (MG) (Sigma-Aldrich, USA) used during the experiments was determined by checking MG toxicity on NRK-52E cells using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay described by Riss et al [26]. In brief, 1X104 cells were seeded in a 96-well plate. After 24 h, cells were exposed to different concentrations MG (1 mM, 500 µM, 250 µM, 125 µM, 62.5 µM, 31.25 µM, 15.625 µM, 7.812 µM, and 3.906 µM), along with an untreated control well, for 24 h . After treating them for 24 h, 10 µl of MTT solution was added to each well at a final concentration of 0.5 µg/ml, and cells were incubated at 37°C in a 5% CO2 atmosphere for 3 h in the dark. Following the incubation period, formazan crystals formed in each well were solubilized using 100 µl dimethyl sulfoxide (DMSO) solution. The absorbance was then measured at 570 nm to determine the viability of cells.
MG Stimulation and Different Treatment Groups
To check the effect of MG on NRK-52E cells, 8 X 105 cells were seeded in a 60 mm culture plates followed by incubation for 24 h. After this, cells received different treatments based on the respective groups like control (only growth medium), MG (medium containing 200 µM MG), and MG + SM 100 µg/ml (medium containing 200 µM MG in the presence of 100 µg/ml SM). The effect of MG-induced stress on kidney cells was assayed by checking the ROS production, lipid peroxidation, argpyrimidine levels, DNA damage, and transcript levels of various genes involved in the progression of DN by qRT PCR.
Estimation of Argypyrimidine
To estimate the levels of argypyrimidine, NRK-52E cells (8 × 106 cells/well) were seeded onto 60mm plates, and the cells were incubated for 24 h. After 24 h, cells were treated with MG, in the presence and absence of SM for 24 h. After the incubation, the cells were lysed using the lysis buffer followed by centrifugation at 16000 rpm for 10 min at 4°C. The supernatant was then analyzed using a fluorescence spectrophotometer (Hitachi, F-7000) with an excitation wavelength of 330 nm and an emission wavelength of 380 nm for the presence of argypyrimidine [27].
ROS Estimation
In order to estimate oxidative stress caused by MG in the presence or absence of SM, the cells were treated with 200 μM MG alone or along with SM and incubated for 24 h. After treatment, cells were incubated with 5(6)-carboxy-20,70-dichlorofluorescein Diacetate (Carboxy-H2-DCFDA) (Sigma-Aldrich, USA) in the dark with a final concentration of 30 μM at 370C for 1 h. The cells were then harvested, washed with PBS, and resuspended in PBS. ROS production in the cells was measured by measuring the fluorescence of the sample at an excitation wavelength - 485 nm and an emission wavelength - 530 nm, using a fluorescence spectrophotometer (Perkin Elmer LS-55, USA [28].
MDA estimation in cells by HPLC
Total malondialdehyde (MDA) in the cultured cells was estimated using HPLC by following the method described by Tukozkan et al with some modifications [29]. Summarily, the medium was removed from the plates and the cells were rinsed with PBS. Cells were homogenized in cold 1.15% KCl to make 10% homogenate. 500 µl of the homogenate was then mixed with 100 µl of 6 M NaOH, and the samples were incubated in a water bath at 60°C for 45 min. The hydrolyzed sample was then acidified with 250 µl of 35% perchloric acid. The samples were subjected to centrifugation at 15000 g for 10 min. After centrifugation, 250 µl of the supernatant was collected and mixed with 25 µl of DNPH solution, followed by 10 min incubation in the dark. The samples were then analyzed by HPLC in an ODS2 reverse column using acetontitrile: water (38:62) containing 0.2% acetic acid as a mobile phase. Isocratic conditions were maintained during HPLC with a flow rate of 1 ml/min and the MDA was detected in the samples at 310 nm with the UV detector with a retention time of about 10 min. The concentration of MDA was detected in the sample by comparing it with the standard curve prepared using 1,1,3,3 tetraethoxypropane.
DNA damage by Comet Assay
To see if MG can induce DNA damage, cells received respective treatments as mentioned earlier for 24 h followed by comet assay as described previously by Fazeli et al with little modifications [30]. In brief, the cells after having mixed with low melting agarose were loaded on a frosted microscopic slide having a thin layer coat of high- melting point agarose. Cells were lysed by immersing the slides in lysing solution containing Triton X-100 (1%), DMSO (10%), and 89% lysis buffer (composition: 10mM Tris, pH 10; 1% Na-sarcosine; 2.5M NaCl and 100mM Na2EDTA) followed by incubation at 4°C in the dark for 1 h. The unwinding of DNA was permitted in alkaline electrophoresis buffer (composition: 300mM NaOH and 1mM Na2EDTA, pH 13) for 20 min at 4°C in the dark, followed by electrophoresis at 4°C, for 20 min under 1 V/cm and 300 mA electrical field. After the electrophoresis, the slides were neutralized in a neutralization buffer (0.4 M Tris, pH 7.5) for 5 minutes. The slides were then stained with 1 X Ethidium Bromide (10X stock of 20 µg/ml) for 5 min, followed by washing with chilled distilled water to remove excess stain. The DNA damage was observed under the fluorescence microscope and the DNA damage was analyzed using the percentage tailing of the DNA.
qRT-PCR
After the respective treatments and incubation period, total RNA was isolated from the cells using Trizol reagent (Invitrogen, USA) as per the manufacturer’s instructions. RNA was quantified using nanodrop (Thermofisher Scientific, USA) and 1 µg of total RNA was used to synthesize cDNA using a high capacity cDNA synthesis kit (Applied Biosystems, USA) as per the manufacturer’s protocol. The mRNA expression of various genes under the investigation was done using PowerUp SyBr green master mix (Applied Biosystems, USA) in an Agilent Mx3005P qRT-PCR system. The cycle conditions for the qRT-PCR are (a) initial denaturation for 10 min at 95°C followed by (b) 40 repeats of denaturation at 95°C for 30 s, (c) annealing time of 1 min at 60°C and (d) extension at 72 °C for 1 min. The fold change in the expression of the genes was calculated using the 2-ΔΔCt method using 18s rRNA as an endogenous control. The list and the sequence of the primers used are shown in Table 1.
Table 1
Primer sequences of the genes under investigation
Gene
|
Forward Primer Sequence
|
Reverse Primer Sequence
|
18 S
|
5’ACGGAAGGGCACCACCAGGA 3’
|
5’CACCACCACCCACGGAATCG 3’
|
RAGE
|
5’ GGTACTGGTTCTTGCTCT 3’
|
5’ATTCTAGCTTCTGGGTTG 3’
|
TNF-α
|
5’ CAAGGAGGAGAAGTTCCCAA 3’
|
5’CTCTGCTTGGTGGTTTGCTA 3’
|
ICAM-1
|
5’CCCCACCTACATACATTCCTAC 3’
|
5’ACATTTTCTCCCAGGCATTC 3’
|
NADPH Oxidase
|
5’ GGCATCCCTTTACTCTGACCT 3’
|
5’ TGCTGCTCGAATATGAATGG 3’
|
IL-6
|
5’ GCCCTTCAGGAACAGCTATGA 3’
|
5’TGTCAACAACATCAGTCCCAAGA 3’
|
CYP2E1
|
5’ CTTCGGGCCAGTGTTCAC 3’
|
5’ CCCATATCTCAGAGTTGTGC 3’
|
TGF-β
|
5’ – TGCTTCAGCTCCACAGAGAA 3’
|
5’ TGTGTTGGTTGTAGAGGGCA 3’
|
IL-1β
|
5’ CCCTGCAGCTGGAGAGTGTGG 3’
|
5’ TGTGCTCTGCTTGAGAGGTGCT 3’
|
Statistical analysis
All experiments were repeated at least thrice. Data were presented as mean ± SEM of three different experiments, analyzed using GraphPad Prism 6 software (GraphPad Software Inc., La Jolla, CA). Differences between groups were analyzed using one-way analysis of variance with Tukey’s multiple comparisons test. A p value less than 0.05 was considered significant.