Influence of Angptl1 on Osteoclast Formation and Osteoblastic Phenotype in Mouse Cells.

doi:10.21203/rs.3.rs-123969/v1

Download PDF

Research Article

Influence of Angptl1 on Osteoclast Formation and Osteoblastic Phenotype in Mouse Cells.

https://doi.org/10.21203/rs.3.rs-123969/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background: Osteoblasts and osteoclasts play important roles during the bone remodeling in the physiological and pathophysiological states. Although angiopoietin family Angiopoietin like proteins (Angptls), including Angptl1, have been reported to be involved in inflammation, lipid metabolism and angiogenesis, the roles of Angptl1 in bone have not been reported so far.

Methods: We examined the effects of Angptl1 overexpression on the osteoblast and osteoclast phenotypes using mouse cell lines.

Results: Angptl1 overexpression significantly inhibited the osteoclast formation and mRNA levels of tartrate-resistant acid phosphatase and cathepsin K enhanced by receptor activator of nuclear factor κB ligand in RAW 264.7 cells. Moreover, Angptl1 overexpression significantly enhanced Osterix mRNA levels, alkaline phosphatase activity and mineralization induced by bone morphogenetic protein-2 in ST2 cells, although it did not affect the expression of osteogenic genes in MC3T3-E1 cells. On the other hand, Angptl1 overexpression significantly reduced the mRNA levels of peroxisome proliferator-activated receptor γ and adipocyte protein-2 induced by adipogenic medium in 3T3-L1 cells.

Conclusions: The present study first indicated that Angptl1 suppresses and enhances osteoclast formation and osteoblastic differentiation in mouse cell line, respectively, although it inhibits adipogenic differentiation of 3T3-L1 cells. These data suggest the possibility that Angptl1 might be physiologically related to bone remodeling.

Orthopedics

Angptl1

Osteoblast

Osteoclast

Adipocyte

Bone

Bone is a living organ that undergoes remodeling throughout life. Bone remodeling is accelerated by the bone resorption by osteoclasts and subsequent bone formation by osteoblasts under the influences of growth factors, cytokines and/or chemokines, such as bone morphological protein (BMP)-2 and stromal derived factor-1 [1, 2]. Osteoclasts and osteoblasts are originated from granulocyte/macrophage-lineage hematopoietic stem cells and mesenchymal stem cells, respectively. In homeostatic balance, bone resorption and formation are balanced so that old bone is continuously replaced by new tissue to accommodate mechanical loading and strain [3]. The remodeling cycle consists of three consecutive phases: absorption, inversion, and formation.

Angiopoietin like proteins (Angptls) contain eight secreted glycoproteins, namely Angptl1 to Angptl8, showing structural similarity to members of angiopoietin family proteins [4]. All Angptls have an amino-terminal coiled-coil domain, a linker region, and a carboxy-terminal fibrinogen-like domain, and bind to the Tie2 receptor similarly to angiopoietin except for Angptl8 (without the carboxy-terminal fibrinogen-like domain). Angiopoietin and Angptls show high similarity among them, but neither of the latter binds to either Tie2 or Tie1 and have generally been considered orphan ligands [5]. Angptls are widely expressed in various tissues, including liver, cardiovascular and hematopoietic system, and play important roles in inflammation, lipid metabolism and angiogenesis [6].

Angiopoietin like protein-1 (Angptl1) with 491 amino acids has firstly been an isolated cDNA as encoding one of the novel angiopoietin like protein family members from human adult heart cDNA. Angptl1, also known as angioarrestin, was the first discovered member of the Angptl family, since it was identified as an anti-angiogenic factor that inhibits cell proliferation, migration and adhesion of endothelial cells [5, 7]. Angptl1 inhibits vascular endothelial growth factor and basic fibroblast growth factor -induced proliferation of the endothelial cells and exerts the anti-apoptotic action through an induction of phosphorylation of extracellular-signal-regulated kinase 1/2 (ERK1/2) and protein kinase Bα in hepatocellular carcinoma [8]. Moreover, Angptl1 and Angptl2 have been reported to be involved in metabolic syndrome in human and rodents [9]. Lin et al. reported that Angptl1/2 enhances the formation of hematopoietic stem and progenitor cells through the interaction with notch receptor signaling in zebrafish [10]. These findings suggest that Angptl1 is related to wide variety of pathophysiological process in various diseases.

Although angiopoietin and Angptls are known as angiogenic growth factors, the studies of Angptl1, Angptl2 and Angptl1/Angptl2-double knockout zebrafish and mice clearly demonstrated that Angptl2 and Angptl1 have angiogenic and anti-angiogenic function in endothelial cells, respectively, although only double knockout zebrafish showed the defects of endothelial development from embryos [11]. Although vessel formation and blood supply are important for the maintenance and activation of bone remodeling, it has not been reported about the roles of Angptl1 in bone metabolism elsewhere. We therefore investigated the effects of Angptl1 on osteoclast formation, osteoblastic differentiation and osteoblast phenotypes using mouse cell-lines.

DNA construction

For DNA construction, the coding region of murine Angptl1 was amplified by PCR with KAPA HiFi DNA Polymerase enzyme (KAPA Biosystems, Wilmington, MA, USA), using cDNA from mouse neonatal liver as a template and primers (Forward: ATAGAGGCTAGCATGAAGGCTTTTGTTTGGAC, Reverse: ATCAACTCGAGTCAGTCAATAGGCTTGATCA), and then the resultant fragment was inserted into pcDNA3.1 (+) vector (Invitrogen, Thermo Fishers Scientific, Waltham, MA, USA) at the NheI/XhoI sites, and the DNA sequence was verified.

Cell culture

Mouse osteoblastic MC3T3-E1 cells (provided by Dr. Kodama, Ohu Dental Collage, Koriyama, Japan) were cultured in αMEM with 10% FBS and 1% penicillin/streptomycin. ST2 cells (RIKEN. Tsukuba, Japan), a mouse mesenchymal cell line, were maintained in RPMI1640 with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. Mouse monocytic RAW 264.7 cells (ATCC, Manassas, VA, USA) and mouse preadipocytic 3T3-L1 cells (ATCC) were cultured in DMEM with high glucose, 10% FBS and 1% penicillin/streptomycin.

Transfection

For transient transfection, the expression vector was transfected into cells using jetPRIME reagent (Polyplus-transfection SA, Illkirch, France) according to the manufacture’s protocol. Six hours later, the cells were supplied with fresh αMEM, RPMI1640 or DMEM with high glucose containing 10% FBS. Forty-eight hours later, the transiently transfected cells were used for experiments.

For stable transfection, empty vector or pcDNA3.1-Angptl1 vector was transfected into ST2 cells using jetPRIME reagent, as described above. The cells were then subjected to the RPMI1640 supplemented with 10% FBS and 300 µg/ml G418 after 48 hrs transfection. The several colonies were obtained and the expression levels of Angptl1 were determined by quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) method.

Osteoclast formation

RAW 264.7 cells were seeded onto 96-well plate at 1000 cells/well. Empty vector- or Angptl1-transfected RAW 264.7 cells were cultured with αMEM, 10% FBS and 50 ng/ml of receptor activator of nuclear factor κB ligand (RANKL) (Wako Pure Chemicals, Osaka, Japan) to induce osteoclast differentiation for 5 days. The cells were fixed with 10% formaldehyde, and tartrate-resistant acid phosphatase (TRAP) staining were performed with TRAP Stain kit (WAKO Pure Chemicals) according to manufacturer’s protocol. TRAP-positive multinuclear cells (MNCs) with three or more nuclei were counted as osteoclasts.

qRT-PCR

Total RNA was extracted from cells using TriSure reagent (Nippon Genetics, Tokyo, Japan) in accordance with the manufacturer’s instructions and real-time PCR was performed as described [12]. Each PCR primer set is shown in Table 1. Expression levels of mRNA were normalized to the relative amount of a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or β-actin.

Table 1

Primers used for quantitative RT-PCR experiments.
Gene		Sequence
Angptl1	Forward	CGACACAGTCCTAACAGCCACCAG
	Reverse	TGACAGTCTTTGAATGGTCCTTC
TRAP	Forward	CAGCTGTCCTGGCTCAAAA
	Reverse	ACATAGCCCACACCGTTCTC
Ctsk	Forward	GAGGGCCAACTCAAGAAGAA
	Reverse	GCCGTGGCGTTATACATACA
NFATc1	Forward	CAAGTCTCACCACAGGGCTCACTA
	Reverse	GCGTGAGAGGTTCATTCTCCAAGT
Runx2	Forward	AAATGCCTCCGCTGTTATGAA
	Reverse	GCTCCGGCCCACAAATCT
Osterix	Forward	AGCGACCACTTGAGCAAACAT
	Reverse	GCGGCTGATTGGCTTCTTCT
ALP	Forward	ATCTTTGGTCTGGCTCCCATG
	Reverse	TTTCCCGTTCACCGTCCAC
Osteocalcin	Forward	CCTGAGTCTGACAAAGCCTTCA
	Reverse	GCCGGAGTCTGTTCACTACCTT
Col1	Forward	AACCCTGCCCGCACATG
	Reverse	CAGACGGCTGAGTAGGGAACA
PPARγ	Forward	CCCAATGGTTGCTGATTACAAA
	Reverse	AATAATAAGGTGGAGATGCAGGTTCT
aP2	Forward	CTTCAAACTGGGCGTGGAA
	Reverse	CCATCTAGGGTTATGATGCTCTTCA
GAPDH	Forward	ACGGCAAATTCAACGGCAC
	Reverse	CTCCACGACATACTCAGCAC
β-actin	Forward	TACCACAGGCATTGTGATGG
	Reverse	TTTGATGTCACGCACGATTT
Angptl1, Angiopoietin like 1; TRAP, Tartrate-resistant acid phosphatase; Ctsk, cathepsin K; NFATc1, nuclear factor of activated T-cells, cytoplasmic 1; Runx2, Runt related transcription factor-2; ALP, alkaline phosphatase; Col1, type I collagen; PPARγ, peroxisome proliferator-activated receptor γ; aP2, adipocyte protein-2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Alkaline phosphatase (ALP) activity

Analysis of ALP activity in ST2 cells was performed, as described previously [13]. ST2 cells transiently expressing empty vector or Angptl1 were grown in 24-well plate. The confluent cells were stimulated with 200 ng/ml BMP-2 (Pfizer, Groton, CT, USA) for 72 hours. Then, the cells were lysed in distilled water and sonicated for 30 seconds on ice. After the lysates were centrifuged, ALP activity in the supernatant were analyzed using Lab assay ALP kit (Wako Pure Chemicals). The absorbance was measured at 405 nm by the Multiskan Go microplate spectrophotometer (Thermo Fishers Scientific). The protein levels in the supernatant were determined by Protein Assay BCA Kit (Wako Pure Chemicals). ALP activity was normalized to the protein levels and expressed as [units/total protein (µg)].

Mineralization

To test the effect of Angptl1 on mineralization, stably empty vector- or Angptl1-overexpressed ST2 cells were grown in RPMI/10%FBS-penicillin/streptomycin containing 300 µg/ml G418 and 200 ng/ml BMP-2 for 1 week to induce osteoblasts, and then changed the mineralization media supplemented with 300 µg/ml G418 for additional 10 days. To detect mineralization level, the cells were fixed with 10% formaldehyde and stained with alizarin red. For the quantitation of mineralization, the resultant cells were destained with cetylpyridinium chloride and the absorbance at 550 nm were measured by the Multiskan Go microplate spectrophotometer (Thermo Fisher Scientific).

Adipogenic differentiation

Confluent grown 3T3-L1 cells were transiently transfected with empty vector- or Angptl1 before the induction of adipogenic differentiation. Then, the medium was changed into high glucose DMEM-10%FBS supplemented with 10 µg/ml insulin, 500 µM 3-isobutyl-1-methyl-xanthine, and 1 nM dexamethasone for 2 days and then changed high glucose DMEM-10%FBS medium for additional 4 days as previously described [14].

Statistical analysis

Data are presented as mean ± SEM. Comparisons between two groups were made with the Mann-Whitney U test. For parametric multiple comparison, one-way or two-way analysis of variance followed by the Dunnett test or Tukey-Kramer test was employed by GraphPad PRISM 7.00 software. Significance was defined as P < 0.05.

Effects of Angptl1 on osteoclast formation

We first examined the effects of Angptl1 on the osteoclast formation. Transient overexpression of Angptl1 significantly decreased the number of TRAP-positive MNCs enhanced by RANKL in mouse monocytic RAW 264.7 cells, compared with empty vector-transfected cells (Fig. 1A). Moreover, Angptl1 overexpression significantly downregulated the mRNA levels of osteoclastic markers, such as TRAP and cathepsin K (Ctsk), enhanced by RANKL, in RAW 264.7 cells, although it seemed to suppress nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1) mRNA levels enhanced by RANKL without significant difference (Fig. 1B).

Effects of Angptl1 on osteoblasts

We examined the effects of Angptl1 on osteoblastic differentiation using ST2 cells, mouse mesenchymal cell line. Transient overexpression of Angptl1 significantly enhanced Osterix mRNA levels and ALP activity enhanced by BMP-2 in ST2 cells, although it significantly reduced osteocalcin mRNA levels enhanced by BMP-2 (Fig. 2A and 2B). Next, we established ST2 cells stably expressing Angptl1 to examine the effects of Angptl1 on mineralization. As shown in Fig. 2C, stable overexpression of Angptl1 enhanced mineralization in ST2 cells pretreated with BMP-2 in the presence of mineralization medium. On the other hand, transient overexpression of Angptl1 did not affect osteoblast phenotypes, such as the mRNA levels of Runx2, Osterix, ALP and osteocalcin in mouse osteoblastic MC3T3-E1 cells (Fig. 3).

Effects of Angptl1 on adipogenic differentiation

We finally examined the effects of Angptl1 on adipogenic differentiation. Mouse preadipocyte cell line, 3T3-L1 cells, transiently overexpressing Angptl1, differentiate to adipocytes in the presence of adipogenic medium for 4 days. Transient overexpression of Angptl1 significantly downregulated the mRNA levels of peroxisome proliferator-activated receptor γ (PPARγ) and adipocyte protein-2 (aP2) enhanced by adipogenic medium in 3T3-L1 cells (Fig. 4).

The present study revealed that Angptl1 overexpression significantly inhibited number of TRAP-positive MNCs as well as the mRNA levels of TRAP and Ctsk in RAW 264.7 cells, indicating that Angptl1 suppresses osteoclast formation, then might lead to a suppression of bone resorption. The mechanisms by which Angptl1 suppresses osteoclast formation have still remained unknown at the present time. Since the effects of Angptl1 on NFATc1 expression seemed to be less than on those of TRAP and Ctsk in RAW 264.7 cells, Angptl1 might differently affect several signaling for osteoclast formation in mice. It has previously been reported that Angptl1 exerts anti-apoptotic activity through the phosphorylation of ERK1/2 and Akt in zebrafish endothelial cells [11]. Moreover, the studies of Akt-deficient mice suggested that Akt signaling is partly related to osteoblastic bone formation and osteoclastic bone resorption in bone remodeling [15, 16], although the previous studies suggest that ERK1/2 and Akt signaling stimulates bone resorption in mice in contrast to the effects of Angptl1 on osteoclast formation [17].

Lu et al. reported that Angptl7, an Angptl family member protein, induces BMP expression and enhances the proliferation and differentiation through the BMP autocrine loop in mouse osteoblastic MC3T3-E1 cells [18]. Angptl2 has been shown as a positive regulator of osteoblastic differentiation, and its expression was suppressed by inflammatory stimuli in vitro [19]. Meanwhile, Angptl2 enhanced cementoblast differentiation partially by activating the ERK1/2 signaling pathway in mouse cementoblast cell line [20]. However, there has been no evidence of Angptl1 in bone metabolism so far. In the present study, Angptl1 overexpression significantly enhanced Osterix mRNA levels, ALP activity and mineralization in the presence of BMP-2 in mouse mesenchymal ST2 cells, although it did not affect the mRNA levels of Runx2, Osterix, ALP and osteocalcin in mouse osteoblastic MC3T3-E1 cells. These data suggest that Angptl1 enhances the mesenchymal cells into osteoblasts at the early stage of osteogenic differentiation, then leading to an enhancement of ALP activity and mineralization. In the present study, Angptl1 overexpression significantly suppressed osteocalcin mRNA levels enhanced by BMP-2 in ST2 cells, suggesting that Angptl1 affects osteoblastic differentiation at the early stage, but not the terminal stage, since osteocalcin has been considered to be late stage osteoblast differentiation marker [21].

Angptl2 has been well-studied in glucose/lipid metabolism. Kadomatsu et al. demonstrated that Angptl2 possesses angiogenic effects, which are related to the chronic inflammation in obesity and cancer metastasis [22–24]. Serum levels of Angptl2 have also been reported in type 2 diabetic and obese patients [25, 26]. These in vitro and clinical studies suggested that Angptl2 is involved in the pathophysiology of metabolic syndrome, such as obesity, although no reports are available about the roles of Angptl1 in adipobiology. We therefore examined the effects of Angptl1 on adipogenic differentiation, since bone metabolism is regulated by the trans differentiation of mesenchymal stem cells into osteogenic or adipogenic cells [27]. In the present study, Angptl1 overexpression significantly decreased the mRNA levels of PPARγ and aP2 during adipogenic induction in mouse preadipocyte cell line, 3T3-L1 cells, suggesting that Angptl1 suppresses adipogenic differentiation in mouse cells. Taken into account into the enhancement of Angptl1 on the mesenchymal cells into osteoblasts at the early stage, Angptl1 induces trans differentiation from adipogenic-lineage into osteogenic lineage cells during bone remodeling or in the pathological state, such as diabetes and obesity.

Bone modeling and remodeling process participate during bone repair after fractures or bone defect [28]. Chondrogenesis, bone formation and bone resorption as well as vessel formation and inflammation are related to this bone repair process. Tanoue et al. evaluated Angptl2 expression and function in chondrocyte differentiation and subsequent endochondral ossification in mice, and they showed that Angptl2 functions as an extracellular matrix protein in chondrocyte differentiation and subsequent endochondral ossification [29]. Therefore, Angptl1 might participate bone repair process by affecting chondrogenesis, bone restoration and remodeling phase, our preliminary study showed that an elevation in Angptl1 mRNA level are not evident at the injured sites after femoral bone defect in mice (data not shown). The roles of Angptl1 in chondrogenesis and bone repair have still remained unknown.

In conclusion, the present study first revealed that Angptl1 overexpression suppresses osteoclast formation in RAW 264.7 cells. Moreover, it enhanced Osterix expression, ALP activity and mineralization induced by BMP-2 in ST2 cells, although it suppressed adipogenic differentiation of 3T3-L1 cells. This is the first report about the roles of Angptl1 in bone. Our data suggest the possibility that Angptl1 might enhance and reduce osteoblastic bone formation and osteoclastic bone resorption in mice, respectively, which might leading to an increase in bone mass and a target of bone metabolic disorders, such as osteoporosis. Further in vivo study using Angptl1-deleted mice is required to clarify the roles of Angptl1 in bone metabolism in the future.

aP2: adipocyte protein-2; ALP: alkaline phosphatase; αMEM: minimum essential medium alpha modification; Angptl1: angiopoietin like protein-1; Angptls: angiopoietin like proteins; BMP-2: bone morphogenetic protein-2; Ctsk: cathepsin K; DMEM: Dulbecco’s modified eagle’s medium; ERK1/2: extracellular-signal-regulated kinase 1/2; FBS: fetal bovine serum; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; MNCs: multinuclear cells; NFATc1: nuclear factor of activated T-cells, cytoplasmic 1; PPARγ: peroxisome proliferator-activated receptor γ; qRT-PCR: quantitative reverse transcriptase-polymerase chain reaction; RANKL: receptor activator of nuclear factor κB ligand; TRAP: tartrate-resistant acid phosphatase.

Ethics approval

Not applicable.

Consent for publication

Not applicable.

Availability of data and material

The data sets used for the current study are available from the corresponding authors upon reasonable request.

Cell line source

ST2 cells were purchased from RIKEN (Tsukuba, Japan). RAW 264.7 and 3T3-L1 cells were obtained from ATCC (Manassas, VA, USA).

Competing interests

The authors declare there are no competing interests.

Funding

This study was partly supported by a grant from The Nakatomi Foundation to M.I., a grant from Grants-in-Aid for Scientific Research (C:20K09514) to H.K. and (C: 19K09659) to M.I., and a Grant-in-Aid for Scientific Research on Innovative Areas (grant number 15H05935, “Living in Space”) from the Ministry of Education, Culture, Sports, Science, and Technology of Japan to H.K.

Authors' contributions

M.I. and H.K. contributed to the conception and design of the research. M.I., N.K., Y.M. and Y.T. performed the experiments. M.I. analyzed the data. M.I. and H.K. interpreted the results of the experiments. M.I. prepared the figures. M.I. drafted the manuscript. M.I. and H.K. edited and revised the manuscript. All authors approved the final version of the manuscript.

Acknowledgments

The authors acknowledge the members of the Life Science Research Institute, Kindai University for their technical support and advice.

Hadjidakis DJ, Androulakis, II. Bone remodeling. Ann N Y Acad Sci. 2006;1092:385-96.
Okada K, Kawao N, Yano M, Tamura Y, Kurashimo S, Okumoto K et al. Stromal cell-derived factor-1 mediates changes of bone marrow stem cells during the bone repair process. Am J Physiol Endocrinol Metab. 2016;310:E15-23.
Frost HM. Skeletal structural adaptations to mechanical usage (SATMU): 2. Redefining Wolff's law: the remodeling problem. Anat Rec. 1990;226:414-22.
Kim I, Kwak HJ, Ahn JE, So JN, Liu M, Koh KN et al. Molecular cloning and characterization of a novel angiopoietin family protein, angiopoietin-3. FEBS Lett. 1999;443:353-6.
Oike Y, Yasunaga K, Suda T. Angiopoietin-related/angiopoietin-like proteins regulate angiogenesis. Int J Hematol. 2004;80:21-8.
Santulli G. Angiopoietin-like proteins: a comprehensive look. Front Endocrinol (Lausanne). 2014;5:4.
Dhanabal M, LaRochelle WJ, Jeffers M, Herrmann J, Rastelli L, McDonald WF et al. Angioarrestin: an antiangiogenic protein with tumor-inhibiting properties. Cancer Res. 2002;62:3834-41.
Chen HA, Kuo TC, Tseng CF, Ma JT, Yang ST, Yen CJ et al. Angiopoietin-like protein 1 antagonizes MET receptor activity to repress sorafenib resistance and cancer stemness in hepatocellular carcinoma. Hepatology. 2016;64:1637-51.
Kadomatsu T, Tabata M, Oike Y. Angiopoietin-like proteins: emerging targets for treatment of obesity and related metabolic diseases. FEBS J. 2011;278:559-64.
Lin MI, Price EN, Boatman S, Hagedorn EJ, Trompouki E, Satishchandran S et al. Angiopoietin-like proteins stimulate HSPC development through interaction with notch receptor signaling. Elife. 2015;4:e05544.
Kubota Y, Oike Y, Satoh S, Tabata Y, Niikura Y, Morisada T et al. Cooperative interaction of Angiopoietin-like proteins 1 and 2 in zebrafish vascular development. Proc Natl Acad Sci U S A. 2005;102:13502-7.
Ishida M, Tatsumi K, Okumoto K, Kaji H. Adipose tissue-derived stem cell sheet improves glucose metabolism in obese mice. Stem Cells Dev. 2020;29:488-97.
Ishida M, Kawao N, Okada K, Tatsumi K, Sakai K, Nishio K et al. Serpina3n, dominantly expressed in female osteoblasts, suppresses the phenotypes of differentiated osteoblasts in mice. Endocrinology. 2018;159:3775-90.
Ishida M, Shimabukuro M, Yagi S, Nishimoto S, Kozuka C, Fukuda D et al. MicroRNA-378 regulates adiponectin expression in adipose tissue: a new plausible mechanism. PLoS One. 2014;9:e111537.
Kawamura N, Kugimiya F, Oshima Y, Ohba S, Ikeda T, Saito T et al. Akt1 in osteoblasts and osteoclasts controls bone remodeling. PLoS One. 2007;2:e1058.
Mukherjee A, Rotwein P. Akt promotes BMP2-mediated osteoblast differentiation and bone development. J Cell Sci. 2009;122:716-26.
Lee K, Seo I, Choi MH, Jeong D. Roles of mitogen-activated protein kinases in osteoclast biology. Int J Mol Sci. 2018;19:3004.
Lu X, Lu J, Zhang L, Xu Y. Effect of ANGPTL7 on proliferation and differentiation of MC3T3-E1 cells. Med Sci Monit. 2019;25:9524-30.
Takano A, Fukuda T, Shinjo T, Iwashita M, Matsuzaki E, Yamamichi K et al. Angiopoietin-like protein 2 is a positive regulator of osteoblast differentiation. Metabolism. 2017;69:157-70.
Jiang C, Liu H, Sun H, Wang X, Liao H, Ma L et al. Downregulation of angiopoietin-like protein 2 inhibits cementoblast differentiation partially by activating the ERK1/2 signaling pathway. Am J Transl Res. 2019;11:314-26.
Li J, Zhang H, Yang C, Li Y, Dai Z. An overview of osteocalcin progress. J Bone Miner Metab. 2016;34:367-79.
Endo M, Nakano M, Kadomatsu T, Fukuhara S, Kuroda H, Mikami S et al. Tumor cell-derived angiopoietin-like protein ANGPTL2 is a critical driver of metastasis. Cancer Res. 2012;72:1784-94.
Kadomatsu T, Endo M, Miyata K, Oike Y. Diverse roles of ANGPTL2 in physiology and pathophysiology. Trends Endocrinol Metab. 2014;25:245-54.
Tian Z, Miyata K, Tazume H, Sakaguchi H, Kadomatsu T, Horio E et al. Perivascular adipose tissue-secreted angiopoietin-like protein 2 (Angptl2) accelerates neointimal hyperplasia after endovascular injury. J Mol Cell Cardiol. 2013;57:1-12.
Doi Y, Ninomiya T, Hirakawa Y, Takahashi O, Mukai N, Hata J et al. Angiopoietin-like protein 2 and risk of type 2 diabetes in a general Japanese population: the Hisayama study. Diabetes Care. 2013;36:98-100.
Endo M, Yamamoto Y, Nakano M, Masuda T, Odagiri H, Horiguchi H et al. Serum ANGPTL2 levels reflect clinical features of breast cancer patients: implications for the pathogenesis of breast cancer metastasis. Int J Biol Markers. 2014;29:e239-45.
McCabe LR. Understanding the pathology and mechanisms of type I diabetic bone loss. J Cell Biochem. 2007;102:1343-57.
Claes L, Recknagel S, Ignatius A. Fracture healing under healthy and inflammatory conditions. Nat Rev Rheumatol. 2012;8:133-43.
Tanoue H, Morinaga J, Yoshizawa T, Yugami M, Itoh H, Nakamura T et al. Angiopoietin-like protein 2 promotes chondrogenic differentiation during bone growth as a cartilage matrix factor. Osteoarthritis Cartilage. 2018;26:108-17.

Download PDF

Editorial decision: Major revision
06 Jan, 2021
Reviews received at journal
20 Dec, 2020
Reviewers agreed at journal
13 Dec, 2020
Reviewers invited by journal
11 Dec, 2020
Editor assigned by journal
11 Dec, 2020
Editor invited by journal
11 Dec, 2020
Submission checks completed at journal
11 Dec, 2020
First submitted to journal
08 Dec, 2020

You are reading this latest preprint version

Influence of Angptl1 on Osteoclast Formation and Osteoblastic Phenotype in Mouse Cells.

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

DNA construction

Cell culture

Transfection

Osteoclast formation

qRT-PCR

Alkaline phosphatase (ALP) activity

Mineralization

Adipogenic differentiation

Statistical analysis

Results

Effects of Angptl1 on osteoclast formation

Effects of Angptl1 on osteoblasts

Effects of Angptl1 on adipogenic differentiation

Discussion

Conclusions

Abbreviations

Declarations

Ethics approval

Consent for publication

Availability of data and material

Cell line source

Competing interests

Funding

Authors' contributions

Acknowledgments

References

Status:

Version 1