Cell culture
Mouse macrophage cell line RAW264.7 was obtained from American Type Culture Collection (Manassas, VA) and were grown in a DMEM medium containing 10% FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin at 37˚C under 5% CO2.
Experimental Infection With Pa
Female C57BL/6J mice (8 week) were purchased from Joint Ventures Sipper BK Experimental Animal (Shanghai, China). The mice were kept at room temperature (controlled at 25℃) with a light-dark cycle of 12 h each day. 6 mice per group for each time point. The experiments were carried out according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals approved by the Animal Ethics Committee of the Scientific Investigation Board of our university and performed as previous reported (7). Briefly, after anesthesia with ether, three 1-mm incisions were made on the left cornea with sterile 25 gauge needle. 5 µL bacterial suspension containing 1 × 106 colony-forming units (CFUs) of PA (ATCC strain 19660) was used locally on the ocular surface. The eyes were examined at indicated time points after the infection for monitoring. After the experiments the mice were sacrificed at indicated time, by an overdose of Isoflurane and euthanasized with cervical dislocation under anesthesia to minimize pain and suffering.
Bacterial Plate Counts
5 days after infection, the corneas were collected, bacterial number was deteced as reported [13]. In short, the cornea was homogenized in sterile water containing 0.85% (w / V) NaCl and 0.25% BSA individually. The 10 fold diluent of the sample was coated on the Pseudomonas Isolation Agar (BD Difco laboratories, Sparks, MD) for three times followed by the incubation overnight at 37 ℃The data were reported as 105 CFU per cornea ± SD.
Lentivirus Preparation And Infection
Lentivirus (Invitrogen, BLOCK-iT™ Lentiviral RNAi Expression System, K4944-00) containing control plasmid or shRNA targeting USP22 were constructed by MDL technology company (MDL biotech, Beijing, China) according to the manufacturer’s instruction. shRNA lentivirus was packaged and titered in HEK293T cells, the enriched lentivirus particle was used for cell infection at 50 MOI with the presence of polybrene. For in vivo infection, the protocol was performed as reported [8]. Lentivirus were subconjunctivally injected into the left eye of C57BL/6J mice (5 µl/mouse at a viral titer of 1 × 108) once a week for 3 times before PA infection.
Quantitative Pcr Analysis
Total RNA was extracted with TRIzol reagent according to the manufacturer’s instructions (Invitrogen) and SYBR RT-PCR kit (Takara Biotechnology) were used for quantitative PCR analysis. Primer sequences were shown in Table 1.
Table 1
List of primers used in the study.
Number | Gene | | Sequence (5’-3’) |
1 | USP22 | F | CCTGCACGTTTTCGTGGAAC |
| | R | TCTCCACGATGTTGGTGAGC |
2 | TNF-α | F | GCCACCACGCTCTTCTGTCT |
| | R | TGAGGGTCTGGGCCATAGAAC |
3 | IL-1β | F | ACCTTCCAGGATGAGGACATGA |
| | R | AACGTCACACACCAGCAGGTTA |
4 | IL-6 | F | ACAACCACGGCCTTCCCTAC |
| | R | CATTTCCACGATTTCCCAGA |
6 | GAPDH | F | AATGACCCCTTCATTGAC |
| | R | TCCACGACGTACTCAGCGC |
Western Blot Analysis And Ubiquitination Assay
The protocols were performed as described previously (8). The cells or corneas were lysed using RIPA buffer (MDL biotech, Beijing, China), and total protein in the supernatants was quantified using a Bio-Rad quantification assay (Bio-Rad Laboratories, Hercules, CA). Equal number of protein (25 µg) was loaded on sodium dodecyl sulfate polyacrylamide gel electrophoresis to separate them from each other and then transferred to a PVDF membrane (Millipore, Billerica, USA) followed by blockade with 2.5% nonfat dry milk for 1 hour. Antibodies for USP22 (#ab195289), K48-linked ubiquitin (linkage-specific K48, #ab140601), TRAF6 (#ab33915) (Abcam, Cambridge, USA) and the antibodies specific for p65 (#8242), phospho-p65 (#3033), IκBα (##4814), phospho- IκBα(#2859) (Cell Signaling Technology Inc, Beverly, USA) and β-Actin (#sc58673) (Santa Cruz Biotechnology, Santa Cruz, USA) were added and incubated overnight at 4 °C. Subsequently, the membranes were applied with the corresponding horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology) and detected with the enhanced chemiluminescence (Thermo Fisher Scientific, Bremen, Germany). The ubiquitination of TRAF6 was detected as described [8].
Statistical analysis
The differences in clinical score between lentivirus treated corneas were tested by the ManneWhitney U test. The other assays were determined by an unpaired, two-tailed Student’s t test. A p value < 0.05 was considered statistically significant.