Naringin suppressing the PI3K/Akt signaling pathway as a drug target in BIU87 cells

doi:10.21203/rs.2.21998/v1

Download PDF

Research article

Naringin suppressing the PI3K/Akt signaling pathway as a drug target in BIU87 cells

https://doi.org/10.21203/rs.2.21998/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Flavonoids are regarded as potential anti-cancer drugs due to their toxicity and anti-proliferation functions. Naringin, which is a kind of flavanone compounds targeting anti-tumor treatment, has been focused on reliving several types of cancers, besides of bladder cancer. This paper was aimed to investigate whether and how naringin induced bladder cancer cells.

Method: MTT, cell-cycle, transwell and cell apoptosis were used to assess the cellular responses. Molecular expressions and the signaling pathway of naringin inducing BIU87 cells were evaluated by western blot and real-time quantitative PCR.

Results: It was found that naringin effectively suppressed proliferation and invasion of BIU87 cells by downregulating the expression of PI3K and its downstream pathway. The corresponding proteins related to viability and motility, including CDK2, Bcl-2 and Fascin, were inhibited.

Conclusion: It can be concluded that naringin targeting to PI3K in bladder tumor cells expressed abundantly and inhibited the growth and invasive ability of tumor cells.

Urology & Nephrology

Naringin

bladder cancer

PI3K

signaling pathway

Bladder cancer, which is a kind of genitourinary malignant disease, accounts for nearly 4.5% of the worldwide cancer burden and has been the fifth most common cancer ^[1–3]. By now, the therapeutic effect of bladder cancer is not ideal because of its complicated biological behavior. Although the chemoprevention in clinic is widespread, urothelial cancer still recurs frequently, even if the primary cancer has been completely removed ^[4]. Nowadays, numerous of tumor suppressor genes, which have been implicated in inducing bladder carcinogenesis, are regarded as novel targets for therapy or prevention this disease^[5].

The phosphatidylinositol 3-kinase (PI3K) signaling pathway plays a vital role in cancer cells growth, proliferation, survival and metabolism. Akt occupies a key regulatory node in the PI3K pathway, below which the pathway branches significantly influence a wide range of cellular processes that promote cell cycle progression, cell growth, energy metabolism and resistance to apoptosis by inhibiting proapoptotic Bcl-2 family members^{[6, 7]}. Suppression of the PI3K/Akt leads to the blockade of cell proliferation, and it demonstrates the cellar responses of diminishing cells cycle progression, promoting cells death during cancer development ^[8]. Accordingly, using the PI3K inhibitors for treatment the bladder cancer can be considered to be a promising method to decrease the tumor suppressive activity ^[9].

Naringin (4', 5, 7-trihydroxy-flavonone-7-rhamnoglucoside) is a citrus flavonoid, which can be found in the pericarp citrus and sour flavor fruits that have been proven no side effects to human bodies ^{[10, 11]}. The bioactivities of naringin and its potential pharmacological properties for treating diseases, including cardiovascular health, hyperglycaemia, and Alzheimer's disease ^[12], and so on, appear to be useful to relieve pains. Recently, naringin was shown anti-cancer activity due to its antioxidant, anti-free radicals, inhibition of proliferation and inducing apoptosis of cancer cells ^[13]. It was reported that naringin could decrease the expression of TNF-α and inhibit the growth of W256 cells significantly ^[14]. Furthermore, naringin also played a protective role in liver and decreased the occurrence of liver cancer ^[15]. Until now, however, the relationship between naringin and inhibitory of bladder cancer has not been well understood. According to the previous studies, we hypothesized that naringin may suppress the bladder cancer due to regulating the corresponding signaling pathways. To assess the hypothesis, the present work investigated the effect of naringin against the proliferation and migration/invasion of bladder cancer cells, expecting to provide more supporting evidences for the application of naringin in bladder cancer therapies in clinic.

Cells culture

Human bladder cancer cell lines (BIU87) and human embryonic kidney 293 cell lines (HEK293), which were obtained from the Type Culture Collection of the Chinese Academy of Sciences, Shanghai, China, were cultured in DMEM medium (Invitrogen, USA) supplemented with 10% fetal bovine serum (FBS, Invitrogen, USA) in an incubator at 37℃.

MTT assays

The MTT assay was performed on manufacturer's specifications strictly. 100 µL cell suspensions at a concentration of 1 × 10⁵ were added in 96-well plates. After attachment, the medium was replaced with DMEM that containing different concentrations of naringin (10 µmol/L, 20 µmol/L, 30 µmol/L). For incubating for 12, 24, 36, 48 and 60 h, respectively, 10 µL modified tetrazolium salt-3-(4–5 dimethylthiozol-2yl)-2-5diphenyl-tetrazolium bromide (MTT, Sigma, USA) solution (5 mg/mL in PBS) was added. For incubating 4 h, 150 µL DMSO was to dissolve the crystals. The optical density at 490 nm was measured by micro-plate reader (Bio-rad, USA). The relative growth rate (RGR) was calculated as follows.

RGR (%)=(OD_treatment/OD_control) × 100%

where OD_treatment is the optical density of naringin treatment group, and OD_control is the optical density of control group.

Cell-cycle assay

BIU87 cells were seeded in 6-well plates and incubated overnight for attachment. Then, medium was replaced with an indicated concentration of naringin. After incubation for 24 h, cells were washed with PBS twice and re-suspended in a staining buffer solution, and then were analyzed with FACS Vantage flow cytometer (Becton Dickinson and Co., USA).

Cell migration and invasion assay

Migration and invasion assays were performed according to the instruction of modified boyden chambers, with the parameters of membrane that 6.5 mm in diameter, 8 µm pore size, Matrigel 100 µg/cm². 100 µL DMEM supplemented with 0.1% bovine serum albumin containing 1 × 10⁵ cells were added into the upper insert. The inserts were then transferred to wells of a 24-well plate filled with 600 µL DMEM containing 10% serum and indicated concentrations of naringin. After incubating for 18 h, non-invaded cells were removed, and the invaded cells were fixed with 95% ethanol, stained with trypan blue, and imaged at 5 random locations.

Cell apoptosis

Cells exposed to naringin at an indicated concentration for 24 h were harvested, washed twice with ice-cold PBS, then re-suspended in the dark with Annexin V-FITC and PI buffer (Sigma, USA). The cells and the corresponding apoptosis rate was analyzed by flow cytometry and Mod Fit LT software.

Hochest 33258 staining

BIU87 cells were treated as the same method as cell apoptosis, and then fixed with 4% polyoxymethylene. After washing, 10 µg/mL hochest 33258 (Merck, Germany) were added to the wells. After incubating at room temperature on a shaker for 30 min out of light, cells were observed with fluorescence microscope after washing with PBS and drying in air.

Reverse transcription and quantitative real-time PCR

Cells were treated using the same protocol as that for cell apoptosis described above. Total RNA was isolated using Trizol reagent (Invitrogen, USA) and was reversed and transcribed into complementary DNA (cDNA) using a RT reaction kit (Promega, USA). Gene expression was quantified by using Mx 3000P real-time PCR system (Applied Biosystems, USA) and SYBR Premix Ex Taq (TaKaRa, Japan). The expression levels were normalized to the housekeeping gene GAPDH. The primer for selected genes is listed in Table 1.

Table 1

Sequences of primer-pairs
Name	Forward primer (5'->3')	Reverse primer (5'->3')
Cyclin E	CCATCATGCCGAGGGAGC	TTTGCCCAGCTCAGTACAGG
CDK2	GCCATTCTCATCGGGTCCTC	ATTTGCAGCCCAGGAGGATT
Bcl-2	GGTGAACTGGGGGAGGATTG	GGCAGGCATGTTGACTTCAC
Bax	AGCTGAGCGAGTGTCTCAAG	GTCCAATGTCCAGCCCATGA
PI3K	GGACCCGATGCGGTTAGAG	ATCAAGTGGATGCCCCACAG
FASCIN	TCTGGGAGTACTAGGGCCAC	CCAGTTTGAAAGGCAAGGGC
GAPDH	GAGAAGGCTGGGGCTCATTT	AGTGATGGCATGGACTGTGG

Western blotting analyses

Cells were treated with the same cells apoptosis method mentioned above and harvested on the ice. The cells were prepared for western blot analysis as described previously ^[16]. The antibodies used for western blotting analysis are PI3K, Fascin, Cyclin E, CDK2 (Bioworld, USA), Akt, phospho-Akt (Ser473) (Santa Cruz, USA), Bax and Bcl-2 (Abcam, USA).

Statistical analysis

Each experiment was repeated at least three times. Data were presented as the mean ± standard (SD). Difference between groups were analyzed by one-way analysis of variance (ANOVA) by SPSS 18.0 software. Significant difference was shown as p < 0.05.

To evaluate the inhibitory effect of naringin against growth of BIU87 and HEK293 cells, the dose-response study with varying concentrations of naringin (0, 10, 20 and 30 µmol/L) was performed. As shown in Fig. 1 (b), the proliferation of BIU87 cells exposure to naringin was inhibited in a concentration dependent manner at any time point, which was compared with that exposure to DMSO. However, different treatments of naringin toward HEK293 cells were not exhibited markedly influence on cells viabilities. In order to further investigate the naringin inhibiting the growth of bladder cancer cells, cycle analysis of BIU87 cells exposed to naringin for 24 h was performed. It was shown that naringin exhibited the ability of inducing a dose-dependent increase in the percentage of cells in G₁ phase and a corresponding decrease in S phase compared to control, which provided more supporting evidence that naringin blocked BIU87 cells at the G₁ phase of the cell cycle, as depicted in Fig. 1 (c). In order to demonstrate the blocking performance on transformation of BIU87 cells from G1 phase to S phase in the cell cycle, western blotting analysis and PCR were used to examine the expression of Cyclin E and CDK2, which are the key regulators in the G₁ phase. The expression levels of Cyclin E and CDK2 in BIU87 cells that treated with 20 or 30 µmol/L naringin for 24 h were decreased, which were shown in Fig. 1 (d) and Fig. 1 (e). It can be concluded that naringin arrested cells at G1 phase and then suppressed cells growth via down-regulated Cyclin E and CDK2.

Hochest 33258 was used to stain the apoptosis of BIU87 cells induced by naringin. Figure 2 (a) shows the naringin-induced apoptotic nucleus of BIU87 cells. It can be observed that the condensed chromatin in naringin treated cells was increased with higher concentration of naringin. Figure 2 (b) depicts the specific values of early apoptosis rates and the scatter plots of BIU87 cells detected by flow cytometry. It was shown that the naringin-induced BIU87 cells exhibited a slightly higher apoptosis level than that control cells incubated with DMSO. Western blot analysis showed that Bax was up regulated and Bcl-2 was down regulated in dose-dependent manner, as plotted in Fig. 2 (c). Furthermore, the Bax and Bcl-2 gene expressions in BIU87 cells were up and down regulated at mRNA level with a significant difference after exposing to 20 and 30 µmol/L naringin (Fig. 2(d)).

Transwell assay (with or without matrigel) was used to evaluate the inhibitory effect of naringin on HEK293 and BIU87 cells. Figure 3 (a) and Fig. 3 (b) show that naringin significantly decreased the tendency of invasion and migration ability of BIU87 cells with an increase of concentration of naringin, whereas that has no remarkable influence on normal HEK293 cells. Figure 3 (c) and Fig. 3 (d) plot the western blot analysis and RT-PCR results of Fascin expression at protein and mRNA levels, respectively, which showed that BIU87 cells exposure to naringin (20 or 30 µmol/L) for 24 h was decreased dramatically.

PI3K/Akt pathway is frequently altered in majority of human cancers, indicating that PI3K might be targeted to influence bladder cancer cells proliferation and migration after inducing with naringin. Accordingly, the PI3K pathway in BIU87 cells was evaluated. As demonstrated in Fig. 4 (a-b), naringin at 20 µmol/L markedly inhibited the expression of PI3K in protein and mRNA levels. The cancer-related cytokines PI3K and Akt^p−Ser473 were obviously negatively regulated after treatment with naringin, whereas the expression of Akt was almost no changing. Furthermore, it can be found from Fig. 4 (c-f), the levels of downstream proteins including CDK2, Cyclin E, Bcl-2 and Fascin were all suppressed by naringin, demonstrating that naringin could effectively restrain proliferation and invasion of BIU87 cells by regulating PI3K/Akt pathway.

Inhibition of PI3K signaling, which is considered as the vital regulator of cancer cells, can diminish cells proliferation, and in some circumstances, promote cells death. Significant efforts on generating and evaluating inhibitors of the PI3K pathway have been made, meanwhile, cancer patients are necessary to define PI3K as a promising target for curing this disease ^{[17, 18]}. The most advanced PI3K pathway inhibitors are rapamycin analogs that specifically inhibit mTORC1^{[19, 20]}. The relationship between the PI3K-AKT-mTOR pathway and cancer development, which induces the genetic variations as a result of bladder cancer risk, have been established ^{[7, 21]}.

Recently, flavonoids isolated from herbs have attracted many researchers interest because of their anticancer effects on various cancer cells. Naringin, which is mainly recognized as blocking PI3K/Akt pathway, appears through cell cycle arrest and apoptosis and finally interrupts cells growth ^[22–24]. It was reported that naringin could inhibit breast cancer, lung cancer and cervical cancer, and so on ^[25–27]. Consistently, we confirmed the antitumor potential of naringin on bladder cancer and focused on how naringin induced PI3K/Akt pathway in bladder cancer cells.

As it knows, the PI3K/Akt mediates cellular processes as a fundamental signaling pathway. In the present study, naringin could effect on suppressing the proliferation, migration and invasion of BIU87 cells with an increase of concentration compared with untreated control cells. Viability of BIU87 cells was inhibited, accompanied with the induction of G1 cell cycle-related proteins, such as CDK2 and cyclin E, which regulated the cell cycle and apoptosis. Usually, cell cycle aperiodicity is a classic feature of tumor cells ^[28]. BIU87 cells treated with naringin accumulated mostly in the G1 phase in a dose-dependent manner, whereas that distributed less in the S phase, indicating that the growth of BIU87 cells were interrupted by blocking G1/S phase progression. Furthermore, downregulating the protein levels of CDK2 and cyclin E, regulating the ratio of G1 phase and S phase, provided molecular evidence for anti-proliferation ^[29].

Apoptosis is programmed cell death ^[30]. Typical pro-apoptotic proteins, such as Bax, translocate to the mitochondrial membrane and make the mitochondrial outer membrane status by the membrane permeable. On the contrary, Bcl-2 is an anti-apoptotic protein, which maintains the mitochondrial membrane status ^{[24, 31]}. Consequently, the equilibrium of the expression levels of pro- and anti-apoptotic proteins is a key factor of cells apoptosis ^[32]. It was found that naringin promoted BIU87 cells apoptosis through downregulating Bcl-2 level and whereas that through increasing Bax expression. The Bax/Bcl-2 ratio of naringin treated cells was higher than that of control, which promoted apoptosis, especially early apoptosis.

Moreover, cells proliferation, migration and invasion of BIU87 stimulated by naringin were also inhibited. In general, fascin is overexpressed in tumor tissues and plays a role in tumor cells invasion and metastasis ^[32]. It was reported that fascin was correlated with breast cancer patients who received chemotherapy, which was mainly mediated via PI3K/Akt pathway ^[34]. The present motility assays demonstrated that naringin suppressed the migration and invasion of BIU87, at the same time down-regulated the fascin. So it can be inferred that naringin modulated PI3K/Akt/ fascin pathway by fascin targeting inhibition of cell invasion and metastasis.

The results corresponding to PI3K provide a supplement for anti-cancer potential of naringin. What’s more, a specific mechanism that naringin targets to PI3K and its downstream signaling pathways mediating BIU87 behaviors, including negatively regulating tumor cells survival and invasion, has been established. The present results have widened the application of PI3K inhibitors and might attracted the researchers’ attention on targeting therapy of bladder cancer. Nevertheless, only a preliminary study on naringin and its effect on BIU87 cells were performed. Further studies should be focused on addressing how naringin plays an essential role and how to regulate PI3K pathway in vivo, providing more evidences for this natural anti-cancer candidate drug in clinic.

This study investigated naringin suppressed the proliferation of BIU87 cells with blocking G1/S phase and inhibiting the expression of CDK2 and Cyclin E. The mechanism of naringin inhibiting BIU87 cells migration and invasion, and inducing apoptosis were due to regulating PI3K/Akt pathway. Thus, these results suggest that naringin can exert antitumor effect on BIU87 cells and can be potentially used as a candidate therapy of bladder cancer in clinic.

List of abbreviations

MTT= modiﬁed tetrazolium salt-3-(4-5 dimethylthiozol-2yl)-2-5diphenyl-tetrazolium bromide; BIU87= human bladder cancer cell lines; PI3K= phosphatidylinositol 3-kinase; CDK2= cyclin-dependent kinases 2; Bcl-2= B-cell lymphoma-2; Akt= protein kinase B; TNF-α= tumor necrosis factor-α; HEK293= human embryonic kidney 293 cell lines; DMEM= dulbecco modified eagle medium; FBS= fetal bovine serum; DMSO= dimethyl sulfoxide; PBS= phosphate buffer saline; SDS-PAGE= sodium dodecylsulphate polyacrylamide gel electrophoresis; PVDF= polyvinylidene difluoride; ECL= enhanced chemiluminescence reagent.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Availability of data and materials

The materials from this study are available from the corresponding author on reasonable request.

Competing interests

The authors declared no competing interests. There was no research involving human participants and animals study. All authors reviewed the manuscript and agreed to publish this paper.

Funding

This work was supported by Technology Planning Projects of Liaoning Province (2013225021), which approved for purchasing reagent and measuring. The work was also supported by Natural Science Foundation of Liaoning Province (2019-BS-255), which approved for purchasing reagent and paper revising and publication.

Authors' contributions

JZ Li: Project development, Data analysis, Manuscript writing. J Zhao: Project development, Data analysis, Manuscript editing. HY Zhang: Data analysis. MX Liu: Data management. X Li: Project development. All authors have read and approved the manuscript.

Acknowledgements

Not applicable.

Keshtkar A, Salehnia Z, Keshtkar A, Shokouhi B (2012) Bladder Cancer Detection Using Electrical Impedance Technique (Tabriz Mark 1). Pathology Research International, (19):470101
Ploeg M, Aben KKKiemeney LA (2009) The present and future burden of urinary bladder cancer in the world. World Journal of Urology 27 (3):289-293
Ching CB, Hansel DE (2010) Expanding therapeutic targets in bladder cancer: the PI3K/Akt/mTOR pathway. Laboratory Investigation 90 (10):1406-1414
Madka V, Asch AS, Rao CV (2017) Targeting Inflammation for Bladder Cancer Chemoprevention. Current Pharmacology Reports (1):1-11
Tanaka T, Miyazawa K, Tsukamoto T, Kuno T, Suzuki K (2011) Pathobiology and chemoprevention of bladder cancer. Journal of oncology 2011:528353. doi:10.1155/2011/528353
Kazlauskas A, Cooper JA (1990) Phosphorylation of the PDGF receptor beta subunit creates a tight binding site for phosphatidylinositol 3 kinase. The EMBO journal 9 (10):3279-3286
Courtney KD, Corcoran RB, Engelman JA (2010) The PI3K pathway as drug target in human cancer. Journal of Clinical Oncology 28 (6):1075-1083
Sathe A, Nawroth R (2018) Targeting the PI3K/AKT/mTOR Pathway in Bladder Cancer. Methods Mol Biol 1655:335-350
Dienstmann R, Rodon J, Serra V, Tabernero J (2014) Picking the point of inhibition: a comparative review of PI3K/AKT/mTOR pathway inhibitors. Molecular cancer therapeutics 13 (5):1021-1031.
Zhang YS, Wang F, Cui SX, Qu XJ (2018) Natural dietary compound Naringin prevents azoxymethane/dextran sodium sulfate-induced chronic colorectal inflammation and carcinogenesis in mice. Cancer Biology & Therapy (3):01-39.
Lim YJ, Kim JH, Pan JH, Kim JK, Park TS, Kim YJ, Lee JH, Kim JH (2018) Naringin Protects Pancreatic Î²-Cells Against Oxidative Stress-Induced Apoptosis by Inhibiting Both Intrinsic and Extrinsic Pathways in Insulin-Deficient Diabetic Mice. Molecular Nutrition & Food Research:1700810.
Anil K, Samrita D, Atish P (2010) Protective effect of naringin, a citrus flavonoid, against colchicine-induced cognitive dysfunction and oxidative damage in rats. Journal of Medicinal Food 13 (4):976-984.
Sheikh Fayaz A, Attia SM, Bakheet SA, Zoheir KMA, Mushtaq Ahmad A, Korashy HM, Abdel-Hamied HE, Ashour AE, Abd-Allah ARA (2015) Naringin Attenuates the Development of Carrageenan-Induced Acute Lung Inflammation Through Inhibition of NF-κb, STAT3 and Pro-Inflammatory Mediators and Enhancement of IκBα and Anti-Inflammatory Cytokines. Inflammation 38 (2):846-857.
Camargo CA, Gomes-Marcondes MC, Wutzki NC, Aoyama H (2012) Naringin inhibits tumor growth and reduces interleukin-6 and tumor necrosis factor alpha levels in rats with Walker 256 carcinosarcoma. Anticancer research 32 (1):129-133.
Chabot GG, Touil YS, Pham MH, Dauzonne D (2010) Flavonoids in Cancer Prevention and Therapy: Chemistry, Pharmacology, Mechanisms of Action, and Perspectives for Cancer Drug Discovery. DOI: 10.1007/978-1-4419-0020-3_23.
Zhao J, Ren L, Liu MX, Xi T, Zhang BC, Yang K (2017) Anti-fibrotic function of Cu-bearing stainless steel for reducing recuurence of ureteral stricture after stent implantation. Journal of biomedical materials research B: Application biomater 106(5): 2019-2028.
Komatsu W, Kishi H, Yagasaki K, Ohhira S (2018) Urolithin A attenuates pro-inflammatory mediator production by suppressing PI3-K/Akt/NF-κB and JNK/AP-1 signaling pathways in lipopolysaccharide-stimulated RAW264 macrophages: Possible involvement of NADPH oxidase-derived reactive oxygen species. European Journal of Pharmacology:S0014299918303558.
Felice FD, Urbano TG (2017) New drug development in head and neck squamous cell carcinoma: The PI3-K inhibitors. Oral Oncology 67:119-123.
Urbanska M, Gozdz A, Swiech LJ, Jaworski J (2012) Mammalian Target of Rapamycin Complex 1 (mTORC1) and 2 (mTORC2) Control the Dendritic Arbor Morphology of Hippocampal Neurons. Journal of Biological Chemistry 287 (36):30240-30256.
Hujber Z, Petővári G, Szoboszlai N, Dankó T, Nagy N, Kriston C, Krencz I, Paku S, Ozohanics O, Drahos L (2017) Rapamycin (mTORC1 inhibitor) reduces the production of lactate and 2-hydroxyglutarate oncometabolites in IDH1 mutant fibrosarcoma cells. Journal of Experimental & Clinical Cancer Research 36 (1):74.
Hahne J, Engel J, Honig A, Meyer S, Zito D, Lampis A, Valeri N (2017) The PI3K/AKT/mTOR-Signal Transduction Pathway as Drug Target in Triple-Negative Breast Cancer. Clinical Cancer Drugs. DOI: 10.1007/978-1-4419-0020-3_23.
Wenshuang L, Changyuan W, Jinyong P, Jing L, Yue J, Qi L, Qiang M, Kexin L, Huijun S (2014) Naringin Inhibits TNF-α Induced Oxidative Stress and Inflammatory Response in HUVECs via Nox4/NF-κ B and PI3K/Akt Pathways. Current Pharmaceutical Biotechnology 15 (12):1173-1182.
Chen M, Peng W, Hu S, Deng J (2018) MiR‑126/VCAM‑1 regulation by naringin suppresses cell growth of human non‑small cell lung cancer. Oncology Letters 15: 6527-6532.
Lee DH, Park KI, Park HS, Kang SR, Nagappan A, Kim JA, Kim EH, Lee WS, Hah YS, Chung HJ (2011) Flavonoids Isolated from Korea Citrus aurantium L. Induce G2/M Phase Arrest and Apoptosis in Human Gastric Cancer AGS Cells. Evid Based Complement Alternat Med 2012 (1):515901.
Hongzhong L, Bing Y, Jing H, Tingxiu X, Xuedong Y, Jingyuan W, Fuling L, Li Z, Hongyuan L, Guosheng R (2013) Naringin inhibits growth potential of human triple-negative breast cancer cells by targeting β-catenin signaling pathway. Toxicology Letters 220 (3):219-228.
Chen M, Weilin P, Shifeng H, Jie D (2018) miR?126/VCAM?1 regulation by naringin suppresses cell growth of human non?small cell lung cancer. Oncology Letters
Ramesh E, Alshatwi AA (2013) Naringin induces death receptor and mitochondria-mediated apoptosis in human cervical cancer (SiHa) cells. Food & Chemical Toxicology An International Journal Published for the British Industrial Biological Research Association 51 (1):97-105.
Cheng-Yun J, Yung Hyun C, Dong-Oh M, Cheol P, Yeong-Min P, Sang-Cheol J, Moon-Soo H, Tae-Ho L, Jae-Dong L, Gi-Young K (2006) Induction of G2/M arrest and apoptosis in human gastric epithelial AGS cells by aqueous extract of Agaricus blazei. Oncology Reports 16 (6):1349-1355.
Wang Y, Baskerville S, Shenoy A, Babiarz JE, Baehner L, Blelloch R (2008) Embryonic stem cell-specific microRNAs regulate the G1-S transition and promote rapid proliferation. Nature Genetics 40 (12):1478-1483.
Wyllie AH (1993) Apoptosis (the 1992 Frank Rose Memorial Lecture). British Journal of Cancer 67 (2):205-208.
Deininger MH, Weller M, Streffer J, Meyermann R (2015) Antiapoptotic Bcl-2 family protein expression increases with progression of oligodendroglioma. Cancer 86 (9):1832-1839.
Narasimhan SR, Yang L, Gerwin BI, Broaddus VC (1998) Resistance of pleural mesothelioma cell lines to apoptosis: relation to expression of Bcl-2 and Bax. American Journal of Physiology 275 (1):165-171.
Zhao H, Yang F, Zhao W, Zhang C, Liu J (2016) Fascin Overexpression Promotes Cholangiocarcinoma RBE Cell Proliferation, Migration, and Invasion. Technology in Cancer Research & Treatment 15 (2):322.
Darnel AD, Emy B, Vollmer RT, Jacques C, Krikor B, Kanishka S, Jie S, Jinsong J, Alaoui-Jamali MA, Bismar TA (2009) Fascin regulates prostate cancer cell invasion and is associated with metastasis and biochemical failure in prostate cancer. Clinical Cancer Research An Official Journal of the American Association for Cancer Research 15 (4):1376-1383.

Download PDF

Version 1

posted

You are reading this latest preprint version

Naringin suppressing the PI3K/Akt signaling pathway as a drug target in BIU87 cells

Status:

Version 1

Abstract

Figures

Background

Methods

Statistical analysis

Results

Discussion

Conclusions

Declarations

References

Status:

Version 1