4.1Sample collection and storage
The animals used in this research were selected from of the veterinary hospital of kangnuo and chongyisheng. The five FIP positive cats(named HF1901, HF1902, HF1903, HF1904 and SH1910) which was displaying symptoms of illness including inappetence, anorexia, weight loss, lethargy, icterus, fever, diarrhea, and thoracic effusion was submitted from animal hospitals(Hefei, ANHUI and Shanghai ). Collection of effusions was performed immediately following euthanasia. All the surviving cats were euthanized with intravenous injection of sodium pentobarbital (100mg/kg) with trained staff. All cats were ensured to be dead after they have no heartbeat and pupil dilation. And animal experiment was approved and performed in compliance with the guidelines of the Animal Research Ethics Board of Shanghai Veterinary Institute (Shanghai, China), CAAS (no. SHVRI-ZD-2019-012).
The sampled tissues included heart, liver, kidney, spleen, lungs and intestine, and were collected into RNAlater (Life Technologies) within 2h of death, as per manufacturer’s instructions and stored in liquid nitrogen pending molecular analysis. Further samples were collected into 10% neutral-buffered formalin and fixed for 24h for histological examination. Body cavity fluid samples were collected into plain and EDTA-anticoagulant blood tubes. Where immediate storage at −80 °C was not possible, fluid was combined with RNAlater (20% v/v) upon collection and moved to long-term storage at −80 °C within 24h.
4.2 Primers and plasmid construction
Primers were selected from the conserved N gene of FIPV (Accession no. DQ010921). The target application was 156 base-pair in length (FIPV Fwd: 5’- ATTGATGGAGTCTTCTGGGTTGC -3’; FIPV Rev:5’- TGAGTTGTTCCTAGATCGGTTCG -3’). Total RNA was extracted from 200 μL of FCWF cells infected with FIPV with a QIAamp Viral RNA Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s instructions, and used immediately for cDNA synthesis. The cDNA synthesis was performed with SuperScript II reverse transcriptase(RT) (Invitrogen, USA). Subsequently, a 1134-bp N region was cloned into the pET-28a plasmid construct the recombinant plasmid, which named N- pET-28a,(FIPV-N-F:5’-CAGGATCCATGGCCACACAGGGACAACG-3’, FIPV-N-R: 5’- CGGAATTCTTAGTTCGTAACCTCATCAATCATCTCAACCTGTGTGTC-3’). The plasmid was determined by Nano drop (Nano Drop 1000, Thermo scientific, Wilmington, DE, USA) , and used to make a standard curve.
4.3 Establishing a standard curve for q-PCR
The recombinant plasmid N- pET-28a was subjected to tenfold serial dilutions from 107 to 103 copies and used to used to build a standard curve for q-PCR. The assay was carried out in a 20 μL reaction mixture containing 20 μg of cDNA, 0.4 μL of each primer, 10 μL of 2 × ChamQ Universal SYBR qPCR Master Mix (Vazyme), and made up to a total volume of 20 μL with RNase-free water (all the reagents provided in the kit) in a step one machine. The following thermal profile was used; 95 °C for 30 sec, 95 °C for 10s and 60 °C for 30 sec for 40 cycles.
4.4 Specificity,Sensitivity and Reproducibility of the q- PCR
The specificity of the q-PCR assay was determined by comparing results when different PEDV, PCV-2, PRRSV, PPV7, FCV, and TEGV were used as templates.
To determine the sensitivity of the q-PCR assay, The standard plasmid was subjected to tenfold serial dilutions from 108 to 101 copies and used to used to determine the conventional PCR and q-PCR lowest detection limit. Each reaction tube contained 1 μg templates and was tested using q-PCR and PCR. Standard plasmid and the negative control samples were amplified three times each. The primers for PCR and q-PCR were the same. PCR products were analyzed using agarose gel electrophoresis.
To determine the reproducibility of the q-PCR assay, the standard plasmid was diluted to 1 × 107-1 × 103 copies/mL and tested by three different people at three times (the same three people were used each time). The variation among the three testers at each test was analyzed.
4.5 viral detect in clinical sample
The five FIP positive cats’ heart, liver, spleen, lung, kidney, duodenum and ascites were obtained. Then, those total RNA was extracted and reverse transcribed into cDNA according to the manufacture’s instruction from the 200mg tissues, respectively. And the q-PCR method was applied to detect the cDNA. Nuclease-free water was used as a negative control, and three replicate reactions were set for each sample.
4.6 Viruses isolation and Histopathology
The sample was adapted and propagated in FCWF cell culture which were grown in Dulbecco’s modified Eagle’s Medium DMEM (Thermo Scientific, USA) supplemented with 10% Fetal Bovine Calf Seru,Penicillin (100 U mL-1) and Streptomycin (100 U mL-1) in 5% CO2 at 37 °C for propagation of these viruses. Until characteristic cytopathic effect (CPE) was observed, the cells were stored at −80 °C and further cells was centrifuged by ultracentrifugation for observation under a transmission electron microscope (Hitachi, Japan). The formalin-fixed tissue samples were subjected to standard processing for histopathology. They were embedded in paraffin wax and sections prepared and stained by Haematoxylin-Eosin. Tissues that were examined histologically included liver, kidney, duodenum, jejunum and ileum.