Cell culture
Primary BMMSCs of SD rats were isolated and purified by AllCells (Alameda, CA, USA), and their phenotype was identified. The cells were recovered and cultured in low glucose Dulbecco's modified Eagle’s medium (DMEM, Gibco, USA) containing 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin/streptomycin (HyClone, USA) at 37 ℃ in 5% CO2. The cells were used between passages 2 and 4.
Lentiviral vector infection of BMMSCs
The short hairpin RNA (shRNA) interference sequence was designed for rat PHD2 according to our previous report[23]. Construction and sequencing of plasmids, packaging and purification of lentiviral vectors were performed by a commercial source (GenePharma, Ltd., Shanghai, China). All lentiviral vectors carried no other exogenous gene except for the green florescent protein (GFP) label. Interference sequences of shRNA are shown in Table 1.
Table 1
shRNA Interference sequences
shRNA
|
|
5’-3’
|
sh-PHD2
|
sense
|
GATCCGTGACTCTTCCAAGGACATCCTTCAAGAGAGGATGTCCTTGGAAGAGTCACTTTTTTG
|
|
antisense
|
AATTCAAAAAAGTGACTCTTCCAAGGACATCCTCTCTTGAAGGATGTCCTTGGAAGAGTCACG
|
Third-generation BMMSCs were seeded in 6-well plates at a density of 1×105 cells/well and cultured at 37 ℃ and 5% in an incubator. The cells were divided into 3 groups: the sh-PHD2 group (lentiviral RNA interference vector), the NC group (negative control of the lentiviral vector) and the CON group (no lentiviral vector). After 24 h of incubation, the lentivirus was added to plates according to the number of cells per well and a multiplicity of infection (MOI) of 100, 150, 200 and 300. Supernatant cell fluid containing the virus was discarded 24 h after infection, and fresh medium was added. Then, the cells were cultured for 48 h. The infection and status of BMMSCs were observed by routine optical microscopy and inverted fluorescence microscopy. PHD2 gene silencing of BMMSCs was assayed for HIF-1α and PHD2 expression by western blots.
For osteogenic differentiation, the growth medium was replaced with osteogenic differentiation medium (α-MEM with 10% FBS, 0.1 μM dexamethasone, 50 μg/mL L-ascorbic acid and 10 mM β-glycerophosphate). On Day 4 and Day 7 of osteogenic induction, the mRNA expression of osteogenesis-related parameters, including Runt-related transcription factor 2 (Runx 2), alkaline phosphatase (ALP), osteocalcin (OCN) and collagen type I (COL-1), was assayed by quantitative real-time polymerase chain reaction (q-PCR).
RNA preparation and q-PCR
The BMMSCs were treated as previously described. After PHD2 gene silencing, the cells treated with Pg-LPS (1 μg/mL)[24] were cultured in osteogenic culture medium. Osteogenic culture medium with Pg-LPS was replaced every 3 days. On Day 4 of osteogenic induction, the mRNA levels of Runx-2, COL-I, HIF-1α and VEGF were assayed by q-PCR.
Total RNA was extracted by TRIzol Reagent (Thermo Fisher Scientific, Carlsbad, USA), and cDNA was prepared by the PrimeScript RT Reagent kit (TaKaRa Bio, Otsu, Japan). Amplification and detection of cDNA were performed using a ViiA™ 7 Real-Time PCR System (Thermo Fisher Scientific, USA) with primers (GenScript, China) and Maxima® SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific). The primers used in the experiments are shown in Table 2. The relative gene expression level was normalized to that of the internal control (GAPDH) based on the 2-ΔΔCt method.
Table 2
Primer sequences
Primer name
|
Forward primer sequence(5’-3’)
|
Reverse primer sequence(5’-3’)
|
GAPDH
|
TGAAGGGTGGAGCCAAAAG
|
AGTCTTCTGGGTGGCAGTGAT
|
HIF-1α
|
AAGCCCAGAGTCACTGGGACT
|
GTACTCACTGGGACTGTTAGGCTC
|
Runx-2
|
CAGACACAATCCTCCCCACC
|
GCCAGAGGCAGAAGTCAGAG
|
ALP
|
GGAGATGGATGAGGCCATCG
|
CGTCCACCACCTTGTAACCA
|
OCN
|
TGACCCATCTCAGAAGCAGA
|
ATGGCTTTCATTGGAGTTGC
|
COL-I
|
TCTGACTGGAAGAGCGGAGAG
|
GAGTGGGGAACACACAGGTCT
|
VEGF
|
GGCTCTGAAACCATGAACTTTCT
|
GCAATAGCTGCGCTGGTAGAC
|
Enzyme-linked immunosorbent assay (ELISA)
BMMSCs from different groups were cultured with Pg-LPS in osteogenic culture media as previously described. The supernatant of cells was collected on Day 4 and centrifuged at 3000 rpm/min for 10 min to remove dead cells and debris. A Quantikine ELISA kit was used to detect the concentration of VEGF (Neobioscience, China).
Western blot
The cell culture protocol was the same as that in 2.3. Total protein was extracted for western blotting on Day 7 of osteogenic induction. Protein expression levels in different groups were measured with PHD2 (Cell Signaling Technology, USA), HIF-1α (Abcam, USA), ALP (Santa Cruz, USA), Runx 2 (Abcam, USA) and COL-I (Proteintech, USA) primary antibodies, and GAPDH (Bioworld Technology, USA) expression served as an internal control. Membranes were exposed to an ECL reagent (Vazyme Biotech, China), and antibody binding was visualized using a Tanon 5200 Luminescent Imaging Workstation (Tanon, China).
ALP staining and alizarin red S (ARS) staining
BMMSCs were cultured and treated as described in previous steps at a density of 5×104 cells/well in 12-well plates. The cells were washed with PBS and then fixed with 4% paraformaldehyde for 30 min. ALP staining was performed on Day 7 of osteogenic differentiation. Then, the plates were stained with the BCIP/NBT alkaline phosphatase staining kit (Beyotime Institute of Biotechnology, China). Mineral deposition was performed on Day 14 of osteogenic differentiation. The cells were examined by alizarin red S (Sigma-Aldrich, USA) according to the manufacturer’s instructions. The unbound dyes were washed with distilled water. All plates were examined using an inverted optical microscope (Olympus IMT-2, Tokyo, Japan), and digital images were saved.
VEGFR inhibitor treatment
After PHD2 gene silencing, the sh-PHD2+LPS group was treated with 1 μM of the VEGFR inhibitor tivozanib (Selleck, US) for 30 min; samples without inhibitor treatment served as controls. The inhibitor treatment continued in subsequent osteogenic induction experiments. Western blots and mineral deposition were measured to assess osteogenic differentiation.
Ligation-induced experimental periodontitis model
Five-week-old female Sprague–Dawley (SD) rats (weighing approximately 200 g) were maintained under specific pathogen-free conditions. All experimental procedures described in this study were approved by the Animal Ethics Committee of Nanjing University (IACUC-2003053). SD rats were randomly divided into six study groups (n = 5/group): 1) the CON group, without ligature or injection; 2) the Lig group, with ligature alone; 3) the NaCl +Lig group, with ligature and 100 μL of 0.9% NaCl injection; 4) the MSC + Lig group, with ligature and 100 μL of transplanted BMMSCs; 5) the NC + Lig group, with ligature and 100 μL of BMMSCs infected with negative control of lentiviral vector; 6) the sh-PHD2 + Lig group, with ligature and 100 μL of BMMSCs infected with lentiviral RNA interference vector. Briefly, 4-0 silk ligatures were ligated firmly and subgingivally around the left maxillary second molars of SD rats. After 2 weeks, experimental periodontitis was determined by clinical examination and HE staining. Then, the BMMSCs with different treatments were dissociated in 0.9% NaCl (1 × 106 cells/mL), and the cell suspensions were injected into the mesial, middle and distal sites of the palatal gingival tissues around the ligatured molar with a 100 μL microsyringe (Hamilton, Switzerland). After 24 h, we collected the relevant gingival tissues and processed them into frozen slices to confirm sh-PHD2 BMMSC (with green fluorescent protein) transplantation. Stem cell treatment was performed every two days. After 2 weeks of cell transplantation, all rats were sacrificed, and the left mandibles were collected for further experimental analyses.
Microcomputed tomography scanning (micro-CT)
After being placed in 4% paraformaldehyde fixative solution for 48 h, the maxillary bones of the SD rats were scanned with a micro-CT machine (Bruker, Karlsruhe, Germany). The scanning parameters were based on an acquisition protocol (70 kV, 353 μA and 18 μm voxel size). The data were reconstructed and imported into CTVox and CTAn software to obtain 3D model reconstruction and osteogenic parameters.
Histological examination
After fixation with 4% paraformaldehyde, all specimens were placed in 10% EDTA decalcifying solution (EDTA, Servicebio, China) for 2 months at room temperature. Histological sections (5 μm) were cut buccolingually for HE (Servicebio, China), Masson trichrome (Servicebio, China) and immunohistochemistry staining (Servicebio, China). Sections were scanned with Pannoramic MIDI (3DHistech, Ltd., Budapest, Hungary) and browsed with CaseViewer software (3DHistech, Ltd., Budapest, Hungary). For HIF-1α and VEGF staining, the positive area of each section was identified and quantified with ImageJ software.
Statistical analysis
All experimental data are presented as the mean ± standard deviation (SD). The differences were evaluated by unpaired t tests or one-way ANOVAs as appropriate. A two-tailed p<0.05 was considered statistically significant. The statistical graphs were produced with GraphPad Prism 8 (GraphPad Software, Inc., USA).