Animals
All experimental procedures and protocols used in this study were approved by the local Animal Care Committee and conformed to the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Male and female Sprague Dawley rats weighing 200–220 g were obtained from the Institute of Experimental Animals of Sun Yat-Sen University and used throughout this study. All animals were housed in separate cages at 23 ± 3˚C, at 50–60% humidity and a 12 h/12 h light-dark cycle and were provided with food and water ad libitum.
Drug administration
Oxaliplatin (Aladdin Reagent CO, Shanghai, China) was dissolved in 5% glucose solution to a concentration of 1 mg/mL. Rats were intraperitoneally (i.p.) injected at 0.4 mg/100 g once per day for 5 consecutive days; control animals were injected with an equivalent volume of the 5% glucose vehicle.
MT2A siRNA or non-targeting control siRNA was designed and purchased from Ribobio Technology (Guangzhou, China). Intrathecal (i.t.) injection of MT2A siRNA or control siRNA (3 nmol, 10 ul) was performed in naïve rats once every three days for a total of three injections. Recombinant AAV-hSyn-MT2A-EGFP (AAV-MT2A-EGFP) and its AAV-EGFP control were designed and constructed by standard methods by BrainVTA (Wuhan, China). Briefly, 150 nL of AAV-MT2A-EGFP or AAV-EGFP was injected intraspinally into both sides of the L5 spinal dorsal horn of naïve rats at 4 injection sites. Oxaliplatin and its vehicle were consecutively administered 21 days after the AAV virus injection.
Behavior assessment
Mechanical allodynia assessment
Von Frey hairs were used to test mechanical allodynia [27]. Briefly, each animal was placed individually in a transparent plastic box and allowed to adapt to the environment for three consecutive days (15 min/day) before behavior tests. Baseline behavioral measurements were taken to assess mechanical allodynia before the administration of test substances or their vehicles. Different strengths of Von-Frey fibers were used alternately to stimulate the mid-plantar surface of the hind paw. If no paw withdrawal reaction occurred, the next stronger fiber was selected for stimulation; if a paw withdrawal reaction occurred, the weaker stimulus was chosen. The absolute paw withdrawal threshold (g) was measured as the force that caused the rat to withdraw its paw. Testing was only performed in the morning hours. The "up and down" method was used to define the mechanical sensitivity that produced a 50% likelihood of paw withdrawal. The values obtained from both hind paws were averaged.
Locomotor activity assessment
An open field was used to assess locomotion. The rats were first placed in the center of a 100 × 100 cm box. After a 1 min habituation to the box environment, the locomotor activity was recorded for a total of 5 min. DigBehv software was used to analyze the total distance traveled while the rat was in the box. This total distance was defined as the locomotor activity.
All behavioral tests were conducted by a researcher who was blinded to the treatment conditions.
RNA Extraction and Real-time Quantitative PCR
The rats were anesthetized with sodium pentobarbital at a dose of 50 mg/kg (i.p.) and quickly sacrificed. The spinal cord was immediately removed, and the L4-L6 segment of the spinal dorsal horn was isolated and stored at -80 °C. Total RNA was extracted from the spinal cord tissues using Trizol reagent (Invitrogen, USA). The subsequent reverse transcription was performed according to the protocol provided with the polymerase chain reaction (PCR) kit (Takara, Shiga, Japan). The cDNA was amplified with specific primers (Table 1) to investigate the mRNA. The qPCR reaction was conducted at 95 °C for 30 seconds, followed by a thermal cycle of 5 seconds at 95 °C, 30 seconds at 60 °C (repeated for 40 cycles), and final stabilization at 95 °C. The expression ratio of mRNA in the spinal dorsal horn was normalized to β-actin and analyzed by the 2−△△CT method.
Table 1
Rat specific primer sequences for the genes used.
Gene | Primer | Sequence |
MT2A | Forward | 5′- TGCAAATGCACCTCCTGCAA − 3′ |
Reverse | 5′- GCACTTGTCCGAAGCCTCTT − 3′ |
IL-1β | Forward | 5′- TGTTTCCCTCCCTGCCTCTGAC − 3′ |
Reverse | 5′- CGACAATGCTGCCTCGTGACC − 3′ |
IL-6 | Forward | 5′-GAGACTTCCAGCCAGTTGCC-3′ |
Reverse | 5′-ACTGGTCTGTTGTGGGTGGTA-3′ |
TNF-α | Forward | 5′-AGCACGGAAAGCATGATCCG-3′ |
Reverse | 5′-TGAGAAGAGGCTGAGGCACA-3′ |
β-actin | Forward | 5′-GGAGATTACTGCCCTGGCTCCTA-3′ |
Reverse | 5′-GACTCATCGTACTCCTGCTTGCTG-3′ |
Western blotting
Rats were sacrificed and the L4-L6 segment of the spinal dorsal horn was isolated and stored as described in Sect. 2.4. The dorsal horn proteins were extracted with RIPA lysate buffer containing a protease cocktail and phosphatase inhibitors. The protein samples were separated by SDS-PAGE and then transferred onto a PVDF membrane. After blocking in block buffer for 1 h at room temperature, the PVDF membrane was incubated overnight at 4 °C with primary antibodies against MT2A (1:1000, abcam), IκB-α (1:2000, abcam), P65 (1:5000, abcam), and GAPDH (1:1000, CST). The blots were then incubated for 1 h at room temperature with the appropriate secondary antibodies. The antigen-antibody complexes were visualized by enhanced chemiluminescence (Pierce), and the selected bands were quantified using a computer-assisted imaging analysis system (NIH Image J).
Extraction of nuclear and cytoplasmic proteins
The nuclear and cytoplasmic proteins isolated from the L4-L6 segment of the spinal dorsal horn were extracted using the NE-PER nuclear and cytoplasmic extraction reagents kit (Thermo) according to the manufacturer’s instructions. Finally, the nuclear and cytoplasmic extracts were analyzed separately by western blot.
Immunohistochemistry
Rats were anesthetized deeply with sodium pentobarbital (50 mg/kg, i.p.) and perfused through the ascending aorta with 4% paraformaldehyde before dissection of the L4-L6 segment of the spinal dorsal horn. The segment tissue was placed into 4% paraformaldehyde for post-fixing overnight, followed by dehydration in 30% sucrose for two nights, and the tissue was then cut transversely into consecutive sections 25 µm thick. The sectioned tissues were incubated overnight at 4 °C with primary antibody for MT2A (1:250, abcam), NeuN (1:200, Chemicon), GFAP (1:200, Chemicon), and Iba1 (1:200, Chemicon), followed by incubation with secondary antibody for 1 h at room temperature. The immunofluorescence of the stained slices was then examined with a Nikon (Nikon, Italy) fluorescence microscope, and images were captured with a Nikon Eclipse Ni-E camera for further analysis.
Coimmunoprecipitation assays (Co-IP)
Coimmunoprecipitation assays were performed with a co-immunoprecipitation kit (Pierce) according to the manufacturer’s instructions, as previously described [28]. In brief, the spinal dorsal horn tissues were quickly minced and homogenized in lysis buffer. The extracted protein (300 µg) was incubated at 4 ˚C overnight with IκB-α antibody (1:50, abcam), and then 20 µL magnetic beads (Millipore, Boston, MA) were added to each sample. The samples were incubated on a 4 ˚C rotary shaker for 4 h, washed with RIPA lysis, and then heated to 96 ˚C for 10 min with 20 µL of loading buffer to elute the immunocomplexes. The immunocomplexes were then analyzed by western blot as described in Sect. 2.5.
Dual luciferase reporter assays
Luciferase reporter and expression plasmids were co-transfected into 293T cells cultured in 24-well plates. After 48 h, the luciferase activity of the cells was measured using the Duo-Luciferase Assay kit (FulenGen, Guangzhou, China). The results were calculated based on the relative ratio of Renilla versus firefly luciferase activity and comparing with control vectors.
Statistical analysis
SPSS 26.0 was used to analyze all the data, which were expressed as means ± SEM. The Shapiro-Wilks test was used to determine normality. One-way ANOVA, Student’s t-test, or the Kruskal-Wallis test (for non-normally distributed data) was used to analyze the histological, western blotting, and qPCR data. Post hoc analyses were performed using Tukey’s Honestly Significant Difference or Dunn’s multiple comparisons test, as appropriate. Behavioral tests were analyzed using the rank sum test when tests of normality were not satisfied. In all cases, a two-tailed P < 0.05 was considered statistically significant.