Ethical consideration
All animal protocols were performed in accordance with the Ethical Committee and Research Deputy of the Islamic Azad University of Shahrekord Branch, Iran for the Care and Use of Laboratory Animals, and were approved by the Institutional Animal Care and Use Committee guidelines of Islamic Azad University, Shahrekord, Iran (14th 2017 with ethics code: IR.IAU.SHK. REC.1397.045).
Bacterial strains, cells and growth conditions
H. pylori strain (ATCC: 43504) was purchased from the Iranian Biological Resource Center (IBRC). This strain was cultivated on the Luria–Bertani (LB) agar )Sodium chloride, 5 g/l; yeast extract, 5 g/l; tryptone, 10 g/l; mixed with agar, 15 g/l) (Difco, USA) at 37 °C overnight. The HDF cells were provided by the National Cell Bank of Iran, Pasteur Institute and were grown in DMEM containing 10% fetal calf serum (FCS) (Gibco, US) with 5% CO2.
DNA extraction and gene amplification
Bacterial DNA was isolated from H. pylori using a commercial DNA extraction kit (QIAamp® DNA Mini Kit, Qiagen, USA) based on the manufacturer’s protocol. The quality of extracted DNA was analyzed by electrophoresis on a 1.0% agarose gel stained with ethidium bromide. DNA concentration was checked using the Thermo Scientific™ NanoDrop 2000 at a wavelength of 230, 260 and 280 nm. The specific primers for cagW gene (Accession Number: JQ685144.1) were designed by Beacon Designer version 7.91 to amplify a 1611 bp fragment. The primers had BamHI and EcoRV restriction sites in forward (TACGGATCCATGAAAAGGACTTTTTTAATAACG) and reverse primer (AACGATATCTTATCCTTTGAACATAGATCCAC), respectively. PCR amplification was carried out in a 25-μL reaction mixture of 1 µg template DNA, 2 mM MgCl2, 200μΜ dNTP mix, 2.5 µl of 10× PCR buffer (20 mM Tris–HCl pH 8.4, 50 mM KCl), 1 µM of each primer and 1 unit of Taq DNA polymerase (Thermo Fisher Scientific, USA). For a negative control, 2 µl of sterile ultra-pure deionized water was used instead of template DNA. The thermal cycling was optimized with initial denaturation at 94 °C for 5 min followed by 33 cycles of denaturation at 95 °C for 1 min, annealing at 62 °C for 1 min, extension at 72 °C for 1 min, and ultimately a final extension at 72 °C for 10 min. Amplified PCR products were then analyzed by electrophoresis in 1.5% agarose gels.
Construction of recombinant plasmids
The amplified cagW fragments were purified by Qiagen gel extraction kit (Qiagen, Germany) and ligated into plasmid vector pcDNA3.1 (+) using PCR cloning kit-Thermo Fisher Scientific according to manufacturer’s protocol. The cloning vector (pcDNA3.1 (+) plus cagW) was transformed into the competent cells E. coli TOP10F′ by calcium chloride (CaCl2) chemical method. To screen the recombinant vectors, the transformants were selected on LB-ampicillin agar plates. The presence of the cagW DNA insert was determined by screening bacterial colonies using PCR. The competent cells were plated on Luria–Bertani (LB) agar plates containing Xgal (20 mg/ml), IPTG (isopropyl-b-D-thiogalactoside) (0.1 M) and the plates were incubated at 30 °C overnight. The white colonies were picked and cultured again in LB broth media enriched with lg ml ampicillin at 30 °C for 10 h. The recombinant vector was purified using Plasmid Mini Extraction Kit (Bioneer, Korea) and was analyzed by specific- cagW primers. To confirm the accuracy of cloning, the recombinant vector was digested with BamHI and EcoRV restriction enzymes to confirm the presence of cagW fragment [24,25].
Preparation of chitosan solutions and plasmid DNA solutions
Chitosan (with a molecular weight of 71.3 kDa and deacetylation degree of 80%) was prepared from Sigma-Aldrich (Sigma, St Louis, MO, USA). To prepare 1.0% chitosan solutions, 1.0 g chitosan was dissolved into solution of 1.0% acetic acid. It is followed by adding acetate (5.0 mmol/L) to reach a final concentration of 250 μg/mL. A total concentration of 100 μg/mL pcDNA3.1 (+)-cagW plasmid DNA solutions was made by adding Na2SO4 solution (5.0 mmol/L).
Preparation of the pcDNA3.1 (+)-cagW-CS-NPs
A complex coacervation method was applied to form the plasmid DNA chitosan nanoparticles. First, both chitosan solutions and the plasmid DNA solutions were located in a water bath of 55 °C for 30 min. Then, the mixture of plasmid DNA solution and the chitosan was blended for 30 s at 2500 r/min. Following centrifugation at 2500 r/min for 10 min at 4 °C, the plasmid DNA chitosan nanoparticles were collected from the precipitate, and were dissolved in phosphate buffered saline (PBS, pH 7.4). The final nanoparticles were named the pcDNA3.1 (+)-cagW-CS-NPs.
Characterization of the pcDNA3.1 (+)-cagW-CS-NPs
Scanning electron microscope (SEM) (Tescan, Vega3 series, USA) was applied to evaluate pcDNA3.1 (+)-cagW-CS-NPs in terms of morphological and surface characteristics. A Zeta Sizer 2000 (Malvern, UK) determined the zeta potentials and dimensional size of the pcDNA3.1 (+)-cagW-CS-NPs. Samples were dissolved in water, and subsequently, calculations were performed at a scattering angle of 90° in 25 °C. Intensity of light scattered from particles characterized the diameter through auto-correlation function, assuming a spherical form of the particles.
Stability of the pcDNA3.1 (+)-cagW-CS-NPs
The stability assessment of the pcDNA3.1 (+)-cagW-CS-NPs was based on gel retardation method. Briefly, 1μg of pure plasmid DNA and the pcDNA3.1 (+)-cagW-CS-NPs containing 1μg of plasmid DNA were incubated with DNase I (1.0 U/mL) at 37 °C for 30 min. To stop the reaction, 1 µl EDTA was added to the solution, and was incubated at 65°C for 5 min. Then, 16 μL of chitosanase (0.2 U/mL) and 4.0 μL of lysozyme (0.2 U/mL) were mixed in a 37°C water bath for 1 h. pcDNA3.1 (+), and the mixture was regarded as negative control. The integrity of plasmid DNA was analyzed using agarose gel electrophoresis.
Transfer into HDF cell
When the confluency of HDF cells reached 80–85%, HDF were seeded into 6-well plates for transfections. Lipofectamin 2000 reagent (Invitrogen, USA) and recombinant pcDNA3.1 (+)-cagW-CS-NPs, pcDNA3.1 (+)-cagW and pcDNA3.1 (+) were mixed by Opti-MEM separately. The mixture of diluted vector and lipofectamin in 1:1 ratio was incubated for 5 min at room temperature. The lipid-DNA complex was then added to the HDF cells in a serum-free DMEM for 6 h. For selection, the serum-free DMEM was then replaced with a fresh medium containing 50 g/ml- Neomycin. The HDF cells transfected with pcDNA3.1 (+) were regarded as control of transfection.
Western blotting
After 36 h post-transfection, the samples derived from recombinant pcDNA3.1 (+)-cagW-CS-NPs, pcDNA3.1 (+)-cagW and control pcDNA3.1 (+) were lysed in RIPA buffer. Extracted proteins were separately electrophoresed on 12% SDS-PAGE gels, and were transferred to nitrocellulose (GE Amersham Biosciences, Piscataway, NJ, USA). Rabbit anti-human cagW antibody at a 1:700 dilution [26] and anti-GAPDH antibody (ab 469) at a 1:700 dilution were incubated at 4 °C overnight. It is followed by adding goat anti-mouse Abs conjugated with HRP (Santa Cruz Biotechnology) to bind the first Abs. Finally, target proteins were detected by ECL reagents.
Quantitative PCR
Total RNA from recombinant pcDNA3.1 (+)-cagW-CS-NPs and pcDNA3.1 (+)-cagW were extracted by the RNA extraction kit (Qiagen, USA). For each sample, RNA concentration was determined by Thermo Scientific™ NanoDrop 2000 at 260/280 nm RNA concentration. The complementary DNA synthesis was performed using the SuperScript™ First-Strand Synthesis System (Invitrogen, USA) in a reaction volume of 20 μL according to the manufacturer’s instructions. The best primer concentrations were identified by performing a series of experiments with varying primer combinations (Table 1). The specific primers were used to quantify cagW mRNA by RT-PCR kit (Takara, Japan) on a Rotor gene 6000 (Corbett Research, Sydney, AU). Gene expression was calculated through the 2−ΔΔCT method, and was normalized to GAPDH levels regarded as the internal control.
Immunofluorescence assay
After 36 h post-transfection, immunofluorescence assays (IFA) were used to detect the expressions of cagW proteins. Briefly, the cells fixed with 4% paraformaldehyde for 24 h were incubated with the primary mouse polyclonal antibody (1:200 dilutions in 0.1 M PBS) against cagW for 1 h. Following 3 times wash with PBS, the cells were incubated with 3% BSA for 30 min for blocking. Fluorescein isothiocyanate (FITC)-labeled goat anti-mouse IgG (Origene, Rockville, MD, USA) (1:200 dilution in 0.1 M PBS) was incubated for 1 h at room temperature. Cells were washed with PBS, and Hoechst 33,342 dye (1 μg/mL; Sigma) was added for 5 min in the dark. The green and blue fluorescence signals were observed under inverted fluorescence microscope (Leica, Germany). The primary antibody was replaced with 3% BSA in PBS as negative controls.
Mice models
Animal protocols were based on the guidelines of the Declaration of Helsinki (1964), and animal studies were approved by Islamic Azad University of Shahrekord, Shahrekord, Iran. BALB/c mice (6–8 weeks-old) purchased from Animal House of Pasteur Institution were used, and they were kept in pathogen free condition. All mice were divided into four groups, and were treated on days 0, 7, 14, 30 and 45. Mice were injected with intramuscular injection of 100 µg/mouse of pcDNA3.1 (+)-cagW-CS-NPs and pcDNA3.1 (+)-cagW vaccines. Control mice were treated by 100 µg empty vector (pcDNA3.1 (+)) and 100 ml PBS.
IgG and IgM antibody in serum
Serum samples were collected from all groups before vaccination 0, 7, 14, 30 and 45 days after injection (0.33 µg/µl × 3 = (100 µg/µl)). The level of IgG and IgM was evaluated by ELISA method according to the manufacturer instructions. First, 10 µL from each sample was added to the specific coated wells followed by washing and incubating goat anti-mouse secondary antibody conjugated with horse-radish peroxidase) HRP). After that, plates were washed and optical density was detected at 460-630 nm.
Detection of cellular immune response
The cellular immune response was performed with regard to the proliferation of lymphocytes, the number of CD4+ and CD8+ T subset lymphocytes and the levels of IFN-γ, IL-2, IL-12 and IL-4 cytokines. The peripheral blood mononuclear cells (PBMCs) from the spleen or peripheral blood were extracted, and then lymphocytes were isolated by Ficoll density gradient centrifugation, and were separated from plasma. The MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide) assay was applied to determine the proliferation of the lymphocytes in triplicates. The population of CD4+ and CD8+ T lymphocyte cells was sorted by flow cytometry. Lymphocytes were incubated with FITC-conjugated anti-CD4+ T cell antibody and phycoerythrin (PE)-conjugated anti-CD8+ T cell antibody (1:1000 dilution) (Sungene, China) at 4 °C for 1 hour. Then, the cells were washed 3 times with cold PBS, and were assessed by flow cytometry. In serum samples and spleen suspension, the IFN-γ, IL-2, IL-12, and IL-4 levels were evaluated using ELISA kits (ABCAM) based on standard curves.
Challenge experiments
To investigate the protective efficacy of different DNA vaccines for H. pylori, all groups were challenged with 1 × 109 CFU H. pylori by p.o. after giving 200 μL of 0.2% sodium bicarbonate solution. The mortality of the challenged mice was monitored for the subsequent 30 days. The bacterial burdens in the liver and gastric were detected at day 7 post infection as previously described [27]. Briefly, the mice were euthanized at day 7 post infection. gastric tissue was cut. The liver was aseptically removed and was macerated by passage through a 3-mL syringe. Gastric tissue and liver were incubated on a brain heart infusion (BHI, BD Difco, NJ, USA) agar medium containing 5% fetal bovine serum (FBS, GE Healthcare, NJ, USA.) at 37 °C for 48 h, and bacterial viable counts were determined. Infection was measured as either mortality or the presence of ≥ 500 CFU of H. pylori per g of liver and per g of gastric tissue during necropsy.
Histological analysis
After procedures for the necropsy at day 0 post infection, the livers of all groups of immunized mice were aseptically harvested and fixed in 10% formalin. The paraffin-embedded tissue sections were prepared on a rotary microtome, and were stained with hematoxylin–eosin by using standard techniques [28]. All sections were examined by light microscopy. Triplicates were completed for each control and sample.
Statistical analysis
GraphPad Prism 5.0 was applied to analyze data and statistical tests. Multiple comparisons between three groups were made by Tukey post hoc. Unpaired t-Test was used to compare the survival rates between immunized mice and the control group. Means were compared by using a one-way analysis of variance (ANOVA), followed by a Tukey–Kramer post hoc test using a 95% confidence interval. Differences were considered significant at p < 0.05.