Adrenomedullin 2 improves bone regeneration in type 1 diabetic rats by restoring imbalanced macrophage polarization and impaired osteogenesis

doi:10.21203/rs.3.rs-130211/v1

Download PDF

Research

Adrenomedullin 2 improves bone regeneration in type 1 diabetic rats by restoring imbalanced macrophage polarization and impaired osteogenesis

https://doi.org/10.21203/rs.3.rs-130211/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Both advanced glycation end products (AGEs) and AGE-mediated M1 macrophage polarization contribute to bone marrow mesenchymal stem cell (BMSC) dysfunction, leading to impaired bone regeneration in type 1 diabetes mellitus (T1DM). Adrenomedullin 2 (ADM2), an endogenous bioactive peptide belonging to the calcitonin gene-related peptide family, exhibits various biological activities associated with the inhibition of inflammation and reduction of insulin resistance. However, the effects and underlying mechanisms of ADM2 in AGE-induced macrophage M1 polarization, BMSC dysfunction, and impaired bone regeneration remain poorly understood.

Methods

The polarization of bone marrow-derived macrophages was verified by flow cytometry analysis. In addition, alkaline phosphatase (ALP) staining, ALP activity detection, and alizarin red staining were performed to assess the osteogenesis of BMSCs. Quantitative real-time polymerase chain reaction, enzyme-linked immunosorbent assay, western blotting, and immunofluorescence staining were used to assess polarization markers, PPARγ/IκBα/NF-κB signaling, and osteogenic markers. In vivo, a distraction osteogenesis (DO) rat model with T1DM was established, and the tibia samples were collected at different time points for radiological, biomechanical, and histological analyses, to verify the effects of ADM2 in terms of bone regeneration and M2 polarization under diabetic conditions.

Results

ADM2 treatment reversed the M1 macrophage polarization induced by AGEs towards the M2 phenotype, which was partially achieved by the PPARγ-mediated inhibition of NF-κB signaling. The PPARγ inhibitor GW9662 significantly attenuated the effects of ADM2. Besides, ADM2 treatment improved the AGE-impaired osteogenic potential of BMSCs in vitro. Furthermore, ADM2 accelerated bone regeneration, as revealed by improved radiological and histological manifestations and biomechanical parameters, accompanied by improved M2 macrophage polarization in diabetic DO rats, and these effects were partially blocked by GW9662 administration.

Conclusions

These results indicate that ADM2 enhances diabetic bone regeneration during DO, by attenuating AGE-induced imbalance in macrophage polarization, partly through PPARγ/IκBα/NF-κB signaling, and improving AGE-impaired osteogenic differentiation of BMSCs simultaneously. These findings reveal that ADM2 may serve as a potential bioactive factor for promoting bone regeneration under diabetic conditions, and imply that management of inflammation and osteogenesis, in parallel, might be a promising therapeutic strategy for diabetic patients during DO treatment.

Stem Cell & Developmental Cell Biology

Orthopedics

Surgery

adrenomedullin 2

diabetes mellitus

bone regeneration

macrophage polarization

bone marrow mesenchymal stem cell

distraction osteogenesis

Distraction osteogenesis (DO) is widely accepted and applied in orthopedics and traumatology, because of its unique osteogenesis-inducing ability[1–3]. In the process of DO, gradual rhythmic traction is applied using an external fixator to fully induce neo-osteogenesis in the distraction zone[4]. However, bone regeneration is a complex physiological process regulated by multiple factors, and therefore various metabolic disorders tend to impair bone regeneration during DO[5]. In clinical practice, diabetes mellitus (DM)-induced impairment of bone regeneration, characterized by a prolonged mineralization phase, is a relatively common condition, which leads to increased patient discomfort and complications[6–8]. As the number of people with DM is on the rise worldwide, with a predicted increase to a population of 592 million in 2035; there is a high demand for developing novel treatment strategies for accelerating bone regeneration in diabetic patients during DO[9].

DM-induced metabolic disorders have been proven to exert detrimental effects on bone regeneration, leading to a greater risk of poor fracture healing or bone grafting failure[6, 10]. Several physiological conditions have been identified to contribute to DM-induced bone regeneration impairment, including insulin deficiency, accumulation of advanced glycation end products (AGEs), and elevated levels of circulatory homocysteine[11, 12]. AGEs are formed by the non-enzymatic reaction of glucose with proteins under diabetic conditions, and upon interaction with its cell membrane-specific receptor affect cellular functions[13]. Previous studies found that the AGE-receptor of AGEs (RAGE) interaction could regulate various cellular signals, such as mitogen-activated protein kinase, hypoxia-induced factor-1α, peroxisome proliferator-activated receptor γ (PPARγ), and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), which results in M1 macrophage polarization[14–17]. Meanwhile, prolonged inflammation mediated by M1 macrophage contributes to impaired osteogenic potential of bone marrow mesenchymal stem cell (BMSC)[18]. Additionally, AGEs have been shown to exert negative effects on stem cell osteogenic differentiation by modulating DNA methylation and the Wingless/Integrated (Wnt) signaling pathway[19]. Consequently, AGEs could be identified as an important therapeutic target to directly and indirectly attenuate BMSC dysfunction under diabetic conditions.

Adrenomedullin 2 (ADM2), also known as intermedin, is an endogenous peptide belonging to the calcitonin gene-related peptide/calcitonin family and is ubiquitously expressed in various tissues[20]. A previous study has reported that systemic ADM2 levels were significantly decreased in diabetic rats compared to healthy individuals, indicating a relationship between low ADM2 levels and DM-related metabolic disorders[21]. ADM2 has also been reported to play protective roles in the cardiovascular and renal systems via multiple mechanisms, such as anti-inflammation and inhibition of oxidative and endoplasmic reticulum stress[22–24]. Additionally, Pang et al. reported that ADM2 treatment could restore the M1/M2 balance and improve systemic insulin sensitivity in hyperhomocysteinemic mice[25]. Considering the increasing recognition of the vital role of M2 macrophage polarization in bone regeneration and decreased levels in DM[26], we speculated that ADM2 treatment might indirectly create a pro-regenerative microenvironment for enhanced bone regeneration under DM conditions, by facilitating a dynamic shift from M1 to M2 macrophage polarization. Moreover, the direct effect of ADM2 on the osteogenic differentiation of AGE-exposed BMSCs also remains largely unknown.

In this study, we first investigated the roles of ADM2 in macrophage polarization and osteogenic differentiation of BMSCs under AGEs exposure, and the underlying mechanisms. Furthermore, a diabetic rat DO model was employed to examine the in vivo effects of ADM2 on bone regeneration and macrophage polarization.

Cell culture

Bone marrow-derived macrophages (BMDMs) and BMSCs were isolated from 4-week-old C57BL/6 male mice and Sprague Dawley (SD) male rats, respectively, by flushing the bone marrow from femurs and tibias with phosphate buffer saline (PBS; HyClone, USA). BMDMs were cultured in Dulbecco’s Modified Eagle’s Medium (HyClone) supplemented with 10% fetal bovine serum (FBS; Gibco, USA), 1% penicillin-streptomycin (P/S; Gibco), and 20% conditioned media collected from L929 cells. BMSCs were cultured in Modified Eagle’s Medium Alpha (HyClone) supplemented with 10% FBS and 1% P/S. All cells were cultured at 37 ℃ in a humidified atmosphere with 5% CO₂.

Macrophage treatment

BMDMs were stimulated with AGEs (200 μg/ml; BioVision, USA) for 48 h in the presence or absence of ADM2 (1 μM; Phoenix Pharmaceuticals, USA). An equal volume of PBS was added to the control group. In addition, GW9662 (2 μM, pretreatment for 2 h; Beyotime) was administrated along with AGEs and ADM2 treatment to verify the molecular mechanism by which ADM2 regulates AGE-induced macrophages.

Flow cytometry analysis

After treatment, BMDMs were fixed with 4% paraformaldehyde (PFA), blocked with 5% bovine serum albumin (BSA), and then incubated with FITC-conjugated F4/80 antibody (eBioscience, USA), APC-conjugated CD206 antibody (eBioscience), and PE-conjugated CD86 antibody (eBioscience) for 30 min. The candidate cells were detected using a BD FACS Caliber flow cytometer and analyzed using FlowJo v10.0 software. F4/80⁺ cells were identified as macrophages, and the expression levels of CD86 and CD206 were detected to evaluate the M1 and M2 polarization states of BMDMs.

Enzyme-linked immunosorbent assay (ELISA)

The media supernatant was collected from the culture of BMDMs and stored at -80 ℃. The concentrations of tumor necrosis factor-α (TNF-α) and transforming growth factor-β (TGF-β) were measured using ELISA kits (Proteintech, China), according to the manufacturer’s protocols.

Immunofluorescence staining

BMDMs were fixed with 4% PFA, washed with PBS thrice, blocked with 5% BSA for 1 h, and then incubated with the primary antibody against p65 (Beyotime) at 4 ℃ overnight. The cells were then incubated with the Cy3-conjugated secondary antibody (Beyotime) at 25 ℃ for 1 h and then stained with 4',6-diamidino-2-phenylindole (DAPI) for 5 min. The activation and nuclear translocation of p65 were observed using a fluorescence microscope.

Osteogenic differentiation and detection

To determine the effects of ADM2 on the osteogenic differentiation of AGE-induced BMSCs, both alkaline phosphatase (ALP) and mineral deposition were detected. Briefly, BMSCs were inoculated in 24-well plates (5×10⁴/well). Upon 80% confluence, the medium was replaced with osteogenic induction medium (OIM: 20 mM β-glycerophosphate, 1 nM dexamethasone, and 50 μM L-ascorbic acid-2-phosphate in the complete medium; Sigma-Aldrich, USA) containing AGEs (200 μg/ml) in the presence or absence of ADM2 (1 μM), and the medium was replenished every 2 d. ALP staining and activity assays were performed 7 d after osteogenic induction according to the manufacturer’s instructions (Beyotime). On the 14th day of differentiation, alizarin red S (ARS; Cyagen Biosciences, China) staining was performed to evaluate mineral deposition. For quantitative analysis of the mineralization, calcium deposition was eluted with 10% (v/v) cetylpyridinium chloride (Sigma-Aldrich), and the OD value was measured at 570 nm.

Quantitative real-time polymerase chain reaction (qRT-PCR) analysis

Total cell RNA was extracted using an RNA Purification Kit (EZBioscience, USA) and cDNA was obtained from 500 ng of total RNA using the Reverse Transcription Kit (EZBioscience). Thereafter, qRT-PCR was performed using SYBR Green qPCR Master Mix (EZBioscience). Relative gene expression levels were calculated by the 2^-^△△^CT method and GAPDH was used as the reference gene for normalization. The primer sequences are shown in Table. 1.

Western blot analysis

Total cell protein was extracted using RIPA lysis buffer with protease inhibitor and protein phosphatase inhibitor (Solarbio, China) at 4 ℃. Protein concentration was determined using a BCA Protein Assay Kit (EpiZyme, China). Equal amounts of protein (30 μg) were subjected to 10% SDS-PAGE and then transferred to a polyvinylidene difluoride membrane (Millipore, USA). After blocking with 5% BSA, the membrane was incubated with primary antibodies at 4 ℃ overnight. Afterward, the membrane was incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Jackson ImmunoResearch, USA) at 25 ℃ for 1 h. Immunoreactive bands were visualized using enhanced chemiluminescence reagent (Millipore) and the grayscale of protein bands were semi-quantified using ImageJ software.

The primary antibodies used in this study included anti-PPARγ (Cell Signaling Technology, USA), anti-IκBα (Cell Signaling Technology), anti-p65 (Cell Signaling Technology), anti-phosphorylated p65 (Cell Signaling Technology), anti-BMP2 (Abcam, UK), anti-OSX (Abcam), anti-OCN (ABclonal, China), and anti-GAPDH (Cell Signaling Technology).

Induction of Type 1 Diabetes mellitus (T1DM) rat model

All experimental procedures were approved by the Animal Research Committee of Shanghai Jiao Tong University Affiliated Sixth People’s Hospital. After fasting for 12 h, a single high dose (65 mg/kg) of streptozotocin (STZ, 10 mg/mL in 0.01 M citrate buffer; Sigma-Aldrich) was intraperitoneally injected to SD rats, weighing 350-400 g, to induce T1DM models. After 7 d of STZ injection, random plasma glucose levels (PGLs) were determined with a glucometer using blood from the tail vein. Rats with PGLs above 16.7 mmol/L were considered as diabetic individuals, and those that failed to reach the target glycemic index were excluded from the study.

Animal surgery and treatment

A total of 36 T1DM SD rats were used in this study and randomly assigned to the DM (n = 12), DM+ADM2 (n = 12) and DM+ADM2+GW9662 (n = 12) groups. Rats injected with an equal volume of citrate buffer were assigned to the non-diabetic control group (n = 12). To establish the DO model, a transverse osteotomy was performed at the midshaft of the right tibia after anesthesia and exposure. Then, a specially designed monoliteral external fixator (Xinzhong Company, China) was mounted to fix the proximal and distal segments of the tibia. Thereafter, surgical incisions were closed layer-wise. The periosteum was preserved as much as possible during the procedure. The DO procedures comprised three phases: latency phase for 5 d, distraction phase for 10 d (0.25 mm every 12 h), and consolidation phase for 4 weeks. ADM2 (200 μg/kg/d) was subcutaneously injected during the consolidation phase to the DM+ADM2 group and DM+ADM2+GW9662 group, and the latter was intraperitoneally administrated GW9662 (1 mg/kg/d). Equal-volume PBS was subcutaneously injected at the same time as the DM and control groups.

Digital radiography and micro-computed tomography (CT)

From the beginning of the consolidation phase, X-ray films which were focused on the distraction gaps were acquired weekly. The lengthened tibia specimens were harvested 2 (n = 6) and 4 (n = 6) weeks after distraction. Micro-CT scanning was performed to quantitatively evaluate bone regeneration in the distraction zone. Thereafter, three-dimensional (3D) reconstructions of the regenerated callus were produced using the CTVox software. Parameters including bone mineral density (BMD) and bone volume/tissue volume (BV/TV) of the regenerated bone were analyzed using the CTAn software.

Biomechanical testing

The mechanical characteristics of the fresh tibia specimens (n = 3) were determined using a four-point bending device after 4-week consolidation. During the test, the tibia specimens were loaded in the anterior-posterior direction with the posterior side in tension. The modulus of elasticity (E-modulus), ultimate load, and energy to failure were recorded and analyzed using Vernier Graphical Analysis software.

Histological and immunohistochemical staining

For histological analyses, after 2 (n = 3) and 4 (n = 3) weeks of consolidation, tibia specimens were fixed in 4% PFA for 24 h, decalcified in 10% ethylene diamine tetraacetic acid (EDTA, pH = 7.4) for 21 d, dehydrated through graded ethanol of increasing concentration, and then embedded in paraffin. Samples were cut into 5 μm-thick longitudinally oriented sections and then subjected to hematoxylin-eosin (H&E), Masson’s trichrome, and Safranine O-Fast Green (SO-FG) staining.

For immunohistochemical staining, sections were incubated in 0.3% hydrogen peroxide for 20 min to quench endogenous peroxidase activity. After antigen retrieval in 0.01 mol/L citrate buffer (pH 6.0) at 65 ℃ for 20 min and blocking with 5% goat serum for 1 h, sections were incubated with anti-OCN antibody (ABclonal) at 4 ℃ overnight. After incubation with secondary antibodies conjugated with HRP at 25 ℃ for 1 h, an HRP-streptavidin system was used to detect positive areas followed by counterstaining with hematoxylin.

Immunofluorescent analysis

CD68 and CD86, or CD68 and CD206 double immunofluorescent staining were performed to detect M1 or M2 macrophages, respectively. After 2 weeks of consolidation, tibia specimens (n = 3) were decalcified in 18% EDTA for 3 d after fixation. Subsequently, the samples were dehydrated in 30% sucrose, embedded in optimal cutting temperature compound, and cut into 10-μm thick longitudinally oriented sections. After blocking with 5% BSA for 1 h, bone sections were incubated with primary antibodies overnight at 4 ℃, followed by incubation with fluorophore-conjugated secondary antibodies at 25 ℃ for 1 h. Nuclei were stained with DAPI. A fluorescent microscope was used for observation and image capture. For semiquantitative analysis, the ratios of CD86⁺CD68⁺/ CD68⁺ cells and CD206⁺CD68⁺/ CD68⁺ cells in the distraction area were calculated using Image-Pro Plus software.

The primary antibodies used in this study included anti-CD68 (Abcam), anti-CD86 (Novus, USA), and anti-CD-206 (Abcam).

Statistical analysis

All data are presented as mean ± standard deviation. The statistical differences were analyzed with Student’s t-test between two groups or one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test among groups using GraphPad Prism 8 software. Results were considered statistically significant at a two-tailed P-value less than 0.05.

ADM2 reversed AGE-induced M1 macrophage polarization to M2 phenotype

AGEs exposure significantly promoted the expression of genes related to M1 polarization, including iNOS, IL-6, and TNF-α (Figure 1 A). However, ADM2 administration reversed the elevated M1 marker genes expression induced by AGEs, and further promoted the expression of genes related to M2 polarization including Arg-1, MRC1, and TGF-β (Figure 1 A, B). The results of flow cytometry showed a similar trend: AGEs exposure amplified the population of M1 macrophages, while ADM2 administration reversed M1 polarization to M2 phenotype (Figure 1 C, D). Additionally, the results detected by ELISA revealed that AGEs significantly promoted the secretion of pro-inflammatory cytokine TNF-α in BMDMs, while ADM2 not only moderated the pro-inflammatory effect of AGEs but also increased the production of the anti-inflammatory molecule TGF-β (Figure 1 E).

ADM2 attenuated AGE-induced activation of NF-κB through PPARγ/IκBα pathway

The NF-κB pathway plays an essential role in M1 macrophage polarization, and PPARγ could modulate NF-κB-dependent inflammation by upregulating the expression of IκBα, a negative regulator of p65[27]. As shown by western blotting, the protein expression of total PPARγ and IκBα was significantly suppressed by AGEs, leading to the activation of NF-κB p65 (Figure 2 A, B), which was also confirmed by immunofluorescence staining for p65 nuclear translocation (Figure 2 C, D). However, ADM2 treatment rescued the expression of PPARγ and IκBα and subsequently diminished the activation and nuclear translocation of p65 (Figure 2 A-D). When BMDMs were treated with the PPARγ antagonist GW9662 along with AGEs and ADM2, the effects of ADM2 on the PPARγ/IκBα/NF-κB pathway were partially abated (Figure 2 A-D), leading to enhanced M1 polarization with respect to gene expression, surface marker expression, and cytokine production (Figure 1 A-E). Therefore, these findings indicated that ADM2 reversed AGE-induced macrophage inflammation via the PPARγ/IκBα/NF-κB pathway.

ADM2 rescued AGE-mediated impairment of osteogenic potential

To investigate the effect of AGEs and the protective potential of ADM2 on the osteogenesis of BMSCs in vitro, ALP staining, ALP activity, and ARS staining were performed. As evidenced by the qualitative and quantitative results, the AGE-induced impairments of ALP activity and matrix mineralization were attenuated by ADM2-treatment (Figure 3 A-D). Moreover, we observed that osteogenic genes, including ALP, OCN, OPN, and OSX, were significantly upregulated after ADM2 treatment (Figure 3 E). As revealed by western blotting, ADM2 treatment re-upregulated the expression levels of BMP2, OCN, and OSX in BMSCs under AGEs exposure (Figure 3 F, G), suggesting that exogenous ADM2 administration partially rescued the osteogenic potential of BMSCs impaired by AGEs.

ADM2 accelerated bone formation and consolidation during DO in diabetic rats

As shown in Figure 4 A, the experimental detection of mechanical properties of the fresh tibia specimens exhibited improved ultimate load, energy to failure, and elasticity modulus in the DM+ADM2 group and jeopardized parameters in the DM+ADM2+GW9662 group (Figure 4 A). Besides, a series of representative X-ray images across the time course of DO showed the progression of bone consolidation (Figure 4 B). Opaque callus appearing in the distraction regenerates was jeopardized in the DM group and rescued by ADM2 treatment in terms of volume and continuity of the callus in the middle of the consolidation phase. However, the recovery of bone regeneration was compromised by GW9662 administration. At the end of the consolidation phase, the cortical bone within the distraction area is nearly continuous with abundant callus in the control and DM+ADM2 groups. Nevertheless, the bone regeneration in the DM and DM+ADM2+GW9662 groups remained unsatisfactory, with a certain amount of neo-callus and discontinuous cortical bone. Similar observations were confirmed by micro-CT examination of distraction regenerates at 2 and 4 weeks after the distraction phase (Figure 4 C). The BMD and BV/TV in the distraction gaps were impaired in the DM group and improved by ADM2 treatment (Figure 4 D). However, GW9662 co-administration partially compromised the protective effect of ADM2 (Figure 4 D), indicating that ADM2 induced preferable bone regeneration in diabetic DO model at least partially through PPARγ activation.

ADM2 administration accelerated mineralized callus formation within the distraction zone

As shown in Figure 5, H&E, Masson’s trichrome, and SO-FG staining of the distraction regenerates revealed various amounts of newly formed trabecular bone, cartilaginous tissue, and fibrous-like tissue, parallel with the distraction forces (Figure 5). Distraction regenerates treated with ADM2 exhibited enhanced bone consolidation at 2 and 4 weeks after distraction in comparison with the DM group, which was evidenced by more mature trabecular bone and less fibrous-like tissue in the ADM2 group (Figure 5). However, the ossification process was impeded by GW9662 (Figure 5). In addition, immunohistochemical analysis of distraction regenerates revealed a similar tendency: the expression of OCN in the control and DM+ADM2 groups was more intense than that in the DM and DM+ADM2+GW9662 groups (Figure 5).

ADM2 restored the imbalance of macrophage polarization during DO in diabetic rats.

To explore whether ADM2 promoted M2 polarization within distraction regenerates, we applied double-immunofluorescence to label M1 (CD68⁺CD86⁺) and M2 (CD68⁺CD206⁺) macrophages. As shown in Figure 6, there was minimal detection of M1 macrophages in the control group, but enriched distribution in the DM group (Figure 6 A, B). However, after ADM2 treatment, the ratio of M1 macrophages significantly decreased (Figure 6 A, B). Conversely, the ratio of M2 macrophages was minimal in the DM group, but increased in the DM+ADM2 group (Figure 6 C, D). Moreover, these effects of ADM2 were mostly compromised by GW9662 administration (Figure 6 A-D). Taken together, these results indicate that ADM2 induced macrophage M2 polarization from the M1 phenotype, in distraction regenerates of diabetic DO rats.

In this study, we found that ADM2 reversed AGE-induced M1 macrophage polarization to M2 phenotype in vitro. In addition, the M2 polarization effect of ADM2 was achieved, at least in part, by the inhibition of NF-κB signaling via the activation of PPARγ. Moreover, we verified the rescue effect of ADM2 on AGE-induced BMSC dysfunction during osteogenic differentiation. In vivo, the rescue effects of ADM2 on bone regeneration and M2 macrophage polarization under DM were verified and the involvement of PPARγ activation in these effects of ADM2 was also investigated. To the best of our knowledge, this is the first study to show that ADM2 can accelerate bone regeneration under diabetic conditions by regulating macrophage polarization and osteogenesis in parallel.

Even with insulin replacement therapy, a high rate of prolonged consolidation is observed in most T1DM patients undergoing DO treatment, and this effect is primarily attributed to impaired bone regeneration[8, 28]. There is considerable evidence to show that BMSCs deteriorate under diabetic conditions and exhibit reduced osteogenic capability[19, 29]. Although the specific mechanism of diabetes-induced BMSC dysfunction is not fully understood, the AGE/RAGE pathway is considered as one of the primary mechanisms. On the one hand, AGEs have been reported to directly interact with RAGE of osteoblast lineage cells and impair osteogenic differentiation by modulating DNA methylation and Wnt signaling[19]. On the other hand, as the knowledge about the cellular mechanisms underlying bone regeneration in DM is expanding, more recent studies have increasingly acknowledged that the osteogenic differentiation of BMSCs is, to a great extent, suppressed by prolonged inflammation under diabetic condition[30]. Since pathologically elevated ratio of M1 macrophages is the fundamental cause of prolonged inflammation, AGE-induced M1 macrophage polarization could be another promising treatment candidate for diabetic bone regeneration in DO[31]. Therefore, the present study established the simultaneous attenuation of AGE-induced M1 polarization and BMSC dysfunction, which intervenes in the indirect and direct factors leading to impaired osteogenesis, as a therapeutic strategy, and verified that ADM2 could indeed improve bone regeneration under diabetic conditions by exerting this dual positive effect (Fig. 7).

The NF-κB family of transcription factors plays an essential role in inflammation and macrophage M1 polarization induced by various molecules, including AGEs[32]. Although there has been abundant research on the NF-κB-inhibiting effect of ADM2, the mechanism by which ADM2 affects NF-κB remains unclear[21, 33, 34]. PPARγ is a key nuclear transcription factor involved in inflammation and macrophage polarization[35, 36]. A recent study verified that PPARγ stimulation could inhibit the activation of NF-κB through upregulation of IκBα expression at the transcriptional level, which retains the NF-κB subunits p50/p65 in a cytoplasmic inactive complex[27]. Of note, ADM2 has been reported to exhibit anti-inflammatory and M2 polarization effects; therefore, we hypothesized that ADM2 might exert a positive effect on PPARγ activation in BMDMs. Indeed, we observed that the ADM2 treatment significantly rescued the expression of PPARγ and IκBα, which was downregulated by AGEs. As expected, the activation and nuclear translocation of NF-κB were also diminished during ADM2-induced M2 macrophage polarization. In the diabetic DO model, ADM2 administration distinctly increased the ratio of M2 macrophages within distraction regenerates. Moreover, the M2 polarization effect of ADM2 in vitro and in vivo could be at least partially reversed by a PPARγ antagonist, indicating that ADM2 might facilitate the dynamic shift from M1 to M2 under diabetic conditions through the PPARγ/IκBα/NF-κB pathway. However, various pathways participate in AGE-induced M1 macrophage polarization under DM conditions, and the comprehensive mechanisms, except for PPARγ activation, induced by ADM2 are poorly understood[37–39]. In addition, in order to inhibit the pathophysiological process caused by AGE/RAGE interaction, direct interventions upstream also represent a potential therapeutic strategy, including inhibition of AGE formation, downregulation of RAGE expression, and blockage of AGE/RAGE interaction[40–42]. Therefore, other feasible mechanisms by which ADM2 accelerates diabetic bone regeneration are yet to be explored.

Although the osteogenic differentiation process was, to a great extent, suppressed by prolonged inflammation under diabetic conditions, AGE could also directly inhibit the osteogenic potential of adipose-derived stem cells[19]. Hence, even though the prolonged inflammation under diabetic conditions could be relieved by ADM2 treatment, the AGE-induced direct osteogenesis impairment still needs to be retrieved for full restoration of bone regeneration under diabetic conditions. In this study, we verified that ADM2 could at least partially rescue the AGE-impaired osteogenic capacity of BMSCs. This discovery, along with the improvement effect of ADM2 on M2 polarization, provided theoretical support for ADM2 facilitating diabetic bone regeneration during DO. Based on previous studies, the inhibitory effect of AGEs on osteogenic differentiation is closely related to DNA methylation and downregulation of the Wnt pathway[19]. Since ADM2 has been shown to activate protein kinase B (AKT) signaling in various cells[43–45], and activated AKT could preserve β-catenin through phosphorylation and inactivation of glycogen synthase kinase-3 β (GSK-3β)[46], we assume that the osteogenesis-protecting effect of ADM2 on BMSCs may contribute to the activation of the AKT/GSK-3β/β-catenin pathway. Although this study does not include an exploration of the mechanisms by which ADM2 directly improves osteogenic potential of BMSCs, further studies are required to help develop a comprehensive and in-depth understanding of the relevance of ADM2 with bone regeneration under diabetic conditions.

The present study has several limitations. First, the detailed mechanisms underlying the ability of ADM2 to activate PPARγ remain to be fully elucidated. Second, the feasible mechanisms contributing to the rescue effect of ADM2 on AGE-impaired osteogenic potential have not been verified. Lastly, although ADM2 could rescue the osteogenic potential of BMSCs impaired by AGEs, this comprehensive effect fails to prove that the pathways regulated by ADM2 are all beneficial to osteogenic differentiation. Since PPARγ is a vital factor for adipogenic differentiation of BMSCs[47], ADM2 may potentially possess the ability to inhibit osteogenesis, contributing to its PPARγ-activating effect, which may lead to ADM2 inhibition of bone regeneration in non-diabetic individuals, thus affecting the indications for the application of ADM2 in clinical practice. Consequently, the effects and mechanisms of ADM2 on the osteogenic differentiation of BMSCs under normal conditions remain to be further investigated.

This study demonstrates that ADM2 reverses AGE-induced M1/M2 imbalance partly through the PPARγ/IκBα/NF-κB signaling pathway and restores AGE-impaired osteogenic potential of BMSCs simultaneously, revealing ADM2 as a novel factor to accelerate bone regeneration under diabetic conditions during DO. Moreover, our study also provides a novel therapeutic strategy for diabetic patients undergoing DO, which is managing both inflammation and osteogenesis parallelly.

ADM2, adrenomedullin 2; AGE, advanced glycation end product; AKT, activate protein kinase B; ALP, alkaline phosphatase; Arg-1, arginase1; ARS, alizarin red S; BMD, bone mineral density; BMDM, bone marrow-derived macrophage; BMP2, bone morphogenetic protein 2; BMSC, bone marrow mesenchymal stem cell; BSA, bovine serum albumin; BV/TV, bone volume/tissue volume; CT, computed tomography; DAPI, 4',6-diamidino-2-phenylindole; DO, distraction osteogenesis; EDTA, ethylene diamine tetraacetic acid; ELISA, enzyme-linked immunosorbent assay; E-modulus, modulus of elasticity; FBS, fetal bovine serum; GSK-3β, glycogen synthase kinase-3 β; H&E, hematoxylin-eosin; hematoxylin-eosin; IL-6, interleukin-6; iNOS, inducible nitric oxide synthase; IκBα, nuclear factor kappa-light-chain-enhancer of activated B cells inhibitor alpha; MRC1, macrophage mannose receptor 1; NF-κB, nuclear factor kappa-light-chain-enhancer of activated B cells; OCN, osteocalcin; OIM, osteogenic induction medium; OSX, osterix; P/S, penicillin-streptomycin; PBS, phosphate buffer saline; PFA, paraformaldehyde; PGL, plasma glucose level; PPARγ, peroxisome proliferator-activated receptor γ; qRT-PCR, quantitative real-time polymerase chain reaction; RAGE, receptor of advanced glycation end product; SD, sprague dawley; SO-FG, safranine O-fast green; STZ, streptozotocin; T1DM, type 1 diabetes mellitus; TGF-β, transforming growth factor β; TNF-α, tumor necrosis factor α; Wnt, wingless/integrated.

Ethics approval and consent to participate

All experimental procedures on Sprague-Dawley rats were performed in accordance with the Animal Research Committee of Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, and in compliance with National Institutes of Health Guide for the care and use of laboratory animals.

Consent for publication

Not applicable

Availability of date and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no conflict of interest.

Funding

The work was sponsored by grants from National Natural Science Foundation of China (82072421) to QLK, National natural science foundation of China youth program (81802156) to JX, National Natural Science Foundation of China (81930069), Major scientific research and innovation project of Shanghai municipal education commission (2019-01-07-00-02-E00043) to YMC.

Authors’ contributions

QLK and JX conceived and designed the experiments. FW performed the experiments. QLK, JX, and FW wrote the manuscript. FW, JX, and QLK analyzed the data and prepared all the figures. LCK, WBW, LS, MWW provided technical support. YMC provided financial support. All authors reviewed and agreed upon the manuscript.

Acknowledgements

Not applicable

Mauffrey C, Barlow BT, Smith W. Management of segmental bone defects. J Am Acad Orthop Surg. 2015; 23: 143-53.
El-Alfy B, El-Mowafi H, El-Moghazy N. Distraction osteogenesis in management of composite bone and soft tissue defects. Int Orthop. 2010; 34: 115-8.
Kong L-c, Li HA, Kang Q-l, Li G. An update to the advances in understanding distraction histogenesis: From biological mechanisms to novel clinical applications. Journal of Orthopaedic Translation. 2020.
Gubin AV, Borzunov DY, Malkova TA. The Ilizarov paradigm: thirty years with the Ilizarov method, current concerns and future research. Int Orthop. 2013; 37: 1533-9.
Loeffler J, Duda GN, Sass FA, Dienelt A. The Metabolic Microenvironment Steers Bone Tissue Regeneration. Trends Endocrinol Metab. 2018; 29: 99-110.
Loder RT. The influence of diabetes mellitus on the healing of closed fractures. Clin Orthop Relat Res. 1988: 210-6.
Murray CE, Coleman CM. Impact of Diabetes Mellitus on Bone Health. Int J Mol Sci. 2019; 20.
Thrailkill KM, Liu L, Wahl EC, Bunn RC, Perrien DS, Cockrell GE, et al. Bone formation is impaired in a model of type 1 diabetes. Diabetes. 2005; 54: 2875-81.
Guariguata L, Whiting DR, Hambleton I, Beagley J, Linnenkamp U, Shaw JE. Global estimates of diabetes prevalence for 2013 and projections for 2035. Diabetes Res Clin Pract. 2014; 103: 137-49.
Moy PK, Medina D, Shetty V, Aghaloo TL. Dental implant failure rates and associated risk factors. Int J Oral Maxillofac Implants. 2005; 20: 569-77.
Lecka-Czernik B. Diabetes, bone and glucose-lowering agents: basic biology. Diabetologia. 2017; 60: 1163-9.
Li J, Zhang H, Yan L, Xie M, Chen J. Fracture is additionally attributed to hyperhomocysteinemia in men and premenopausal women with type 2 diabetes. J Diabetes Investig. 2014; 5: 236-41.
Singh R, Barden A, Mori T, Beilin L. Advanced glycation end-products: a review. Diabetologia. 2001; 44: 129-46.
He S, Hu Q, Xu X, Niu Y, Chen Y, Lu Y, et al. Advanced glycation end products enhance M1 macrophage polarization by activating the MAPK pathway. Biochem Biophys Res Commun. 2020; 525: 334-40.
Han X, Ma W, Zhu Y, Sun X, Liu N. Advanced glycation end products enhance macrophage polarization to the M1 phenotype via the HIF-1α/PDK4 pathway. Mol Cell Endocrinol. 2020; 514: 110878.
Jin X, Yao T, Zhou Z, Zhu J, Zhang S, Hu W, et al. Advanced Glycation End Products Enhance Macrophages Polarization into M1 Phenotype through Activating RAGE/NF-κB Pathway. Biomed Res Int. 2015; 2015: 732450.
Guo M, Xiao J, Sheng X, Zhang X, Tie Y, Wang L, et al. Ginsenoside Rg3 Mitigates Atherosclerosis Progression in Diabetic apoE-/- Mice by Skewing Macrophages to the M2 Phenotype. Front Pharmacol. 2018; 9: 464.
Loi F, Córdova LA, Zhang R, Pajarinen J, Lin TH, Goodman SB, et al. The effects of immunomodulation by macrophage subsets on osteogenesis in vitro. Stem Cell Res Ther. 2016; 7: 15.
Zhang M, Li Y, Rao P, Huang K, Luo D, Cai X, et al. Blockade of receptors of advanced glycation end products ameliorates diabetic osteogenesis of adipose-derived stem cells through DNA methylation and Wnt signalling pathway. Cell Prolif. 2018; 51: e12471.
Naot D, Musson DS, Cornish J. The Activity of Peptides of the Calcitonin Family in Bone. Physiol Rev. 2019; 99: 781-805.
Li H, Bian Y, Zhang N, Guo J, Wang C, Lau WB, et al. Intermedin protects against myocardial ischemia-reperfusion injury in diabetic rats. Cardiovasc Diabetol. 2013; 12: 91.
Zhang SY, Xu MJ, Wang X. Adrenomedullin 2/intermedin: a putative drug candidate for treatment of cardiometabolic diseases. Br J Pharmacol. 2018; 175: 1230-40.
Qiao X, Li RS, Li H, Zhu GZ, Huang XG, Shao S, et al. Intermedin protects against renal ischemia-reperfusion injury by inhibition of oxidative stress. Am J Physiol Renal Physiol. 2013; 304: F112-9.
Ni XQ, Lu WW, Zhang JS, Zhu Q, Ren JL, Yu YR, et al. Inhibition of endoplasmic reticulum stress by intermedin1-53 attenuates angiotensin II-induced abdominal aortic aneurysm in ApoE KO Mice. Endocrine. 2018; 62: 90-106.
Pang Y, Li Y, Lv Y, Sun L, Zhang S, Li Y, et al. Intermedin Restores Hyperhomocysteinemia-induced Macrophage Polarization and Improves Insulin Resistance in Mice. J Biol Chem. 2016; 291: 12336-45.
Horwood NJ. Macrophage Polarization and Bone Formation: A review. Clin Rev Allergy Immunol. 2016; 51: 79-86.
Scirpo R, Fiorotto R, Villani A, Amenduni M, Spirli C, Strazzabosco M. Stimulation of nuclear receptor peroxisome proliferator-activated receptor-γ limits NF-κB-dependent inflammation in mouse cystic fibrosis biliary epithelium. Hepatology. 2015; 62: 1551-62.
Ho-Shui-Ling A, Bolander J, Rustom LE, Johnson AW, Luyten FP, Picart C. Bone regeneration strategies: Engineered scaffolds, bioactive molecules and stem cells current stage and future perspectives. Biomaterials. 2018; 180: 143-62.
Sun Y, Zhu Y, Liu X, Chai Y, Xu J. Morroniside attenuates high glucose-induced BMSC dysfunction by regulating the Glo1/AGE/RAGE axis. Cell Prolif. 2020; 53: e12866.
Hu Z, Ma C, Rong X, Zou S, Liu X. Immunomodulatory ECM-like Microspheres for Accelerated Bone Regeneration in Diabetes Mellitus. ACS Appl Mater Interfaces. 2018; 10: 2377-90.
Boniakowski AE, Kimball AS, Jacobs BN, Kunkel SL, Gallagher KA. Macrophage-Mediated Inflammation in Normal and Diabetic Wound Healing. J Immunol. 2017; 199: 17-24.
Baker RG, Hayden MS, Ghosh S. NF-κB, inflammation, and metabolic disease. Cell Metab. 2011; 13: 11-22.
Xiao F, Wang D, Kong L, Li M, Feng Z, Shuai B, et al. Intermedin protects against sepsis by concurrently re-establishing the endothelial barrier and alleviating inflammatory responses. Nat Commun. 2018; 9: 2644.
Lu WW, Jia LX, Ni XQ, Zhao L, Chang JR, Zhang JS, et al. Intermedin1-53 Attenuates Abdominal Aortic Aneurysm by Inhibiting Oxidative Stress. Arterioscler Thromb Vasc Biol. 2016; 36: 2176-90.
Olefsky JM, Glass CK. Macrophages, inflammation, and insulin resistance. Annu Rev Physiol. 2010; 72: 219-46.
Huang S, Zhu B, Cheon IS, Goplen NP, Jiang L, Zhang R, et al. PPAR-γ in Macrophages Limits Pulmonary Inflammation and Promotes Host Recovery following Respiratory Viral Infection. J Virol. 2019; 93.
Xu X, Qi X, Shao Y, Li Y, Fu X, Feng S, et al. Blockade of TGF-β-activated kinase 1 prevents advanced glycation end products-induced inflammatory response in macrophages. Cytokine. 2016; 78: 62-8.
Liu Z, Ma Y, Cui Q, Xu J, Tang Z, Wang Y, et al. Toll-like receptor 4 plays a key role in advanced glycation end products-induced M1 macrophage polarization. Biochem Biophys Res Commun. 2020; 531: 602-8.
Dong MW, Li M, Chen J, Fu TT, Lin KZ, Ye GH, et al. Activation of α7nAChR Promotes Diabetic Wound Healing by Suppressing AGE-Induced TNF-α Production. Inflammation. 2016; 39: 687-99.
Alam MM, Ahmad I, Naseem I. Inhibitory effect of quercetin in the formation of advance glycation end products of human serum albumin: An in vitro and molecular interaction study. Int J Biol Macromol. 2015; 79: 336-43.
Matsui T, Higashimoto Y, Nishino Y, Nakamura N, Fukami K, Yamagishi SI. RAGE-Aptamer Blocks the Development and Progression of Experimental Diabetic Nephropathy. Diabetes. 2017; 66: 1683-95.
Qiao J, Chen L, Huang X, Guo F. Effects of nebulized N--acetylcystein on the expression of HMGB1 and RAGE in rats with hyperoxia--induced lung injury. J Cell Physiol. 2019; 234: 10547-53.
Song JQ, Teng X, Cai Y, Tang CS, Qi YF. Activation of Akt/GSK-3beta signaling pathway is involved in intermedin(1-53) protection against myocardial apoptosis induced by ischemia/reperfusion. Apoptosis. 2009; 14: 1299-307.
Teng X, Song J, Zhang G, Cai Y, Yuan F, Du J, et al. Inhibition of endoplasmic reticulum stress by intermedin(1-53) protects against myocardial injury through a PI3 kinase-Akt signaling pathway. J Mol Med (Berl). 2011; 89: 1195-205.
Zhang W, Wang LJ, Xiao F, Wei Y, Ke W, Xin HB. Intermedin: a novel regulator for vascular remodeling and tumor vessel normalization by regulating vascular endothelial-cadherin and extracellular signal-regulated kinase. Arterioscler Thromb Vasc Biol. 2012; 32: 2721-32.
Sun M, Chi G, Xu J, Tan Y, Xu J, Lv S, et al. Extracellular matrix stiffness controls osteogenic differentiation of mesenchymal stem cells mediated by integrin α5. Stem Cell Res Ther. 2018; 9: 52.
Kawai M, Rosen CJ. PPARγ: a circadian transcription factor in adipogenesis and osteogenesis. Nat Rev Endocrinol. 2010; 6: 629-36.

Table 1 Primers for quantitative real-time polymerase chain reaction (qRT-PCR)

Gene	Forward (5’–3’)	Reverse (5’–3’)
ALP	CCGCAGGATGTGAACTACT	GGTACTGACGGAAGAAGGG
Arg-1	CAGAAGAATGGAAGAGTCAG	CAGATATGCAGGGAGTCACC
GAPDH (Mouse)	AAATGGTGAAGGTCGGTGTG	AGGTCAATGAAGGGGTCGTT
GAPDH (Rat)	ATGGCTACAGCAACAGGGT	TTATGGGGTCTGGGATGG
IL-6	AGCCAGAGTCCTTCAGAGAGAT	GCACTAGGTTTGCCGAGTAGAT
iNOS	CGAGACGGATAGGCAGAGATTG	CTCTTCAAGCACCTCCAGGAA
MRC1	CCTATGAAAATTGGGCTTACGG	CTGACAAATCCAGTTGTTGAGG
OCN	CAGACAAGTCCCACACAGCA	CCAGCAGAGTGAGCAGAGAGA
OPN	GGCCGAGGTGATAGCTT	CTCTTCATGCGGGAGGT
OSX	GGAAAAGGAGGCACAAAGAA	CAGGGGAGAGGAGTCCATT
TGF-β	CGGAGAGCCCTGGATACCA	GCCGCACACAGCAGTTCTT
TNF-α	GCTGAGCTCAAACCCTGGTA	CGGACTCCGCAAAGTCTAAG

Download PDF

Review #2 received at journal
03 Apr, 2021
Review #3 received at journal
03 Apr, 2021
Editorial decision: Major Revision
03 Apr, 2021
Reviewer #5 agreed at journal
30 Mar, 2021
Reviewer #4 agreed at journal
29 Mar, 2021
Reviewer #3 agreed at journal
28 Mar, 2021
Reviewer #2 agreed at journal
27 Mar, 2021
Review #1 received at journal
27 Dec, 2020
Reviewers invited by journal
19 Dec, 2020
Reviewer #1 agreed at journal
19 Dec, 2020
Editor assigned by journal
15 Dec, 2020
Submission checks completed at journal
15 Dec, 2020
Editor invited by journal
15 Dec, 2020
First submitted to journal
14 Dec, 2020

You are reading this latest preprint version

Adrenomedullin 2 improves bone regeneration in type 1 diabetic rats by restoring imbalanced macrophage polarization and impaired osteogenesis

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Tables

Status:

Version 1