After approval by the Institutional Review Board (IRB) had been obtained, patients presenting for cataract surgery were recruited for this study from October 2016 to May 2017 at the Department of Ophthalmology, Medical School of the National University of Asunción, Paraguay. Cataract surgery is routinely performed at this institution using clear-cornea incision phacoemulsification technique. Those patients with decompensation or pathological clinical condition prior to surgery were excluded.
Conjunctival samples and patient data
The ophthalmologist responsible for the surgery was in charge of collecting the samples and completing the patient's data sheet. Four conjunctival samples were collected from upper/lower fornix of each patient using individual sterile cotton swabs moistened with thioglycolate broth; one sample at each of the following times: T0: sample taken from the eye to be operated before irrigation with 5% povidone iodine solution (5% PVI), T1: from the fellow eye, T2: from the eye to be operated after 5% PVI disinfection and T3: of the operated eye at the end of the surgery.
The patient data sheet included general characteristics (sex, age, medical history, side of the operated eye, duration of surgery). In addition, contamination by Coagulase-negative Staphylococci (CNS) species, antibiotic resistance / susceptibility profile, the presence of mecA, ica y atlE genes and MLTS profile were registered.
Microbiological study
Each sample was inoculated directly into blood agar / chocolate agar. Subsequently, the swab was placed in a tube of thioglycolate broth. The primary plates of blood agar / chocolate agar were incubated at 35 ° C in an atmosphere of 5% CO2 for 72 h and every 24 h were observed in order to detect bacterial development, and in positive case the colony count was performed. The thioglycolate broth was incubated at 35 ° C for 5 days observing every 24 h the bacterial development by degree of turbidity and recorded in crosses: +, ++ and +++ according to the presence of light, moderate or intense turbidity. Bacteria were identified and tested for antibiotic susceptibility by the Kirby Bauer method against the following drugs: Cefoxitin 30 ug, Erythromycin 15 ug, Clindamycin 2 ug, Penicillin 6 ug, Chloramphenicol 30 ug, Trimethoprim / Sulfamethoxazole 1.25 / 23.75 ug, Ciprofloxacin 5 ug, Gentamicin 10 ug, Tobramycin 10 ug, Moxifloxacin 5 ug, Tetracycline 30 ug, Novobiocin 5 ug, Polymyxin B 100 IU (Biorad, USA) in accordance with Clinical Laboratory Standards Institute guidelines [15].
DNA extraction
DNA extraction was performed according to a modified lysis method described by Zhang et al. 2004 [16], one to five bacterial colonies obtained from 24-48 hours culture in blood agar were suspended in 200 μl sterile distilled water and heated at 100°C for 15 min, freezed for 5 min, and then centrifuged at 13.000 rpm for 1min, supernatant was stored at – 20ºC until use.
Amplification by Multiplex PCR
Multiplex PCR for identifying genes: mecA, ica, and atlE was performed according to the method described by Sharma et al. 19[26]. Some changes were introduced to the original protocol. 25 uL master mix 1.5 mM MgCl2, 0.4 mM de dNTPs, 1 mM of each primer, 5 U/ul Taq polimerase and 5 μl of the extracted DNA was added as template.
The oligonucleotide primers used in this study were described by Sharma et al. [17]. The sequence of forward and reverse primers (Bangalore Genei, Bengaluru, Karnataka, India) were as follows: gen ica: Forward ica-TTATCAATGCCGCAGTTGTC e Inverse ica–GTTTAACGCGAGTGCGCTAT, (product size: 546 pb); gen mecA: mecA1– GTAGAAATGACTGAACGTCCGATAA and mecA2- CCAATTCCACATTGTTTCGGTCTAA, (product size: 310 pb), and gen AtlE: Forward atlE-CAACTGCTCAACCGAGAACA and inverse AtlE– TTTGTAGATGTTGTGCCCCA, (product size: 682 pb).
Staphylococcus aureus ATTCC 43300 was used as positive control for mecA gen. A strong biofilm S. epidermidis producer isolated from a patient was used as positive control for atlE, ica genes and double distilled water as negative control.
PCR was performed in a thermocycler PTC-100 (MJ Research. MA, USA) under the following conditions: 30 cycles of denaturation at 94°C for 1 min, followed by annealing at 55°C for 1 min, and extension at 72°C for 2 min. PCR products and 100 pb molecular marker (BIORON) were run at 100 volts for 1 hour in 1.5 % agarose gel and TAE 1X buffer (Tris-Acetate-EDTA) and visualized by staining with 5% SYBR® Safe DNA gel stain (Invitrogen, USA).
Clonality
The single enhanced MLST scheme described by Thomas et al. [18] was used, which develops an MLST scheme consisting of the seven most discriminatory alleles of three schemes. The PCR involved an initial denaturation of 95 ° C for 3 minutes; 34 cycles of 95 ° C for 30 s, 50 ° C for 1 minute and 72 ° C for 1 minute; and a final extension of 72 ° C for 10 min. The amplicons were further purified and sequenced. The alleles at each locus were distinguished by using Sequence Output software (available from http://www.mlst.net). Lineages were analyzed by using the eBURST algorithm [19] available at http://eBURST.mlst.net.
Modified primer sequences for an improved S. epidermidis MLST scheme
|
Gen
|
Primer
|
Sequence 5´→3´
|
|
gtr
|
gtr-F
gtr-R
|
CAGCCAATTCTTTTATGACTTTT GTGATTAAAGGTATTGATTTGAAT
|
|
mutS
|
mustS-F3
mutS-R3
|
GATATAAGAATAAGGGTTGTGAA GTAATCGTCTCAGTTATCATGTT
|
|
tpi
|
tpi-F2
tpi-R2
|
ATCCAATTAGACGCTTTAGTAAC TTAATGATGCGCCACCTACA
|
|
yqiL
|
yqiL-F2
yqiL-R2
|
CACGCATAGTATTAGCTGAAG CTAATGCCTTCATCTTGAGAAATAA
|
|
pyrR
|
pyr-F2
pyr-R4
|
GTTACTAATACTTTTGCTGTGTTT GTAGAATGTAAAGAGACTAAAATGAA
|
|
arcC
|
arcC-F
arcC-R
|
TGTGATGAGCACGCTACCGTTAG TCCAAGTAAACCCATCGGTCTG
|
|
aroE
|
aroE-F
aroE-R
|
CATTGGATTACCTCTTTGTTCAGC CAAGCGAAATCTGTTGGGG
|
The new gene sequences reported in this study have been deposited in the GenBank (access numbers DQ991011 to DQ991028).
The data were analyzed by descriptive statistics, using the Epi info 3.5.1 program (CDC, Atlanta). Results are expressed as an absolute and relative percentage frequency distribution.