Age-dependent pathogenic characteristics of SARS-CoV-2 infection in ferrets

doi:10.21203/rs.3.rs-131380/v1

Download PDF

Article

Age-dependent pathogenic characteristics of SARS-CoV-2 infection in ferrets

https://doi.org/10.21203/rs.3.rs-131380/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

The sero-prevalence of SARS-CoV-2 in healthy people is not significantly different among age groups, but persons age 65 years or older had strikingly higher COVID-19 mortality compared to younger individuals. To understand COVID-19 manifestations in patients of different ages, ferrets in three age groups were infected with SARS-CoV-2. Although SARS-CoV-2 was isolated from all ferrets regardless of age, aged ferrets (≥3 years old) showed higher viral load, longer nasal virus shedding, and more severe lung inflammatory cell infiltration and clinical symptom compared to ≤6 months juvenile and 1-2 years young adult groups. Transcriptome analysis of aged ferret lungs revealed strong enrichment of gene sets related to type I interferon, activated T cell, and M1 macrophage responses, mimicking the gene expression profile of severe COVID-19 patients. Thus, SARS-CoV-2-infected aged ferrets highly recapitulate COVID-19 patients with severe symptoms and are useful for understanding an age-associated infection, transmission, and pathogenesis of SARS-CoV-2.

Applied & Industrial Microbiology

Virology

COVID-19

age-dependent

ferrets

pathogenesis

clinical manifestations

Coronavirus Disease 2019 (COVID-19) is caused by a novel emerging Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2)¹. Since the first outbreak in China in November 2019, COVID-19 has rapidly and globally spread with high mortality, resulting in a serious threat worldwide. Thus, the World Health Organization (WHO) declared SARS-CoV-2 a pandemic on March 11, 2020². SARS-CoV-2 is the third identified epidemic coronavirus transmitted from animals to humans since 2002, with SARS-CoV³ and Middle East Respiratory Syndrome Coronavirus (MERS-CoV)⁴. However, the magnitude of impact of SARS-CoV-2 infection is by far the greatest due to the significantly larger number of human cases, and consequently, higher mortality.

Despite strict precautionary measures, such as social distancing policies and restriction of social meetings, the number of COVID-19 patients is on a continuous exponential growth, and proportionately, showing increasing mortality rate⁵. Fortunately, licensed COVID-19 vaccines with high efficacy have been developed in record time. It is expected that by the end of next year, all populations will have access to these safe and effective vaccine treatments against COVID-19 that has caused a major chaos on the entire planet. However, with the major discrepancy of age distribution seen in severe COVID-19 patients, it is necessary to seek appropriate active treatment methods through understanding the risk of infection in high-risk groups. Although patients with COVID-19 are distributed among all age groups, the most severe COVID-19 patients were 30 to 79 years of age (87%), while younger patients aged 10 to 19 years only comprised about 1% of total cases⁶. Moreover, higher morbidity and mortality rates have consistently been observed in aged human populations throughout the COVID-19 pandemic⁷. Similarly, mouse-adapted SARS-CoV showed strong age-dependent disease phenotypes in mouse model^8,9. Furthermore, when compared to young adult population, the aged population was generally more susceptible to respiratory infections and shows a poor prognosis¹⁰. These indicate that age is a critical factor for COVID-19 viral disease severity.

In addition to the various clinical symptoms reported for COVID-19, systematic experimental studies are needed to further dissect the diverse disease manifestations among different age groups. While human clinical studies are highly valuable, a number of limitations, including ethical issues, behavioral and environmental variables, and medical history of the patients, may restrain from defining the fundamental cause of the disease in a timely manner. The current hACE2 transgenic mouse model that expresses the entry receptor for SARS-CoV-2, human ACE2, showed weight loss and virus replication in lungs following SARS-CoV-2 infection; however, no other clinical symptoms were observed^11,12, urging for an animal model that could better represent the human disease state. Following the fortuitous discovery in the 1930s that ferrets have natural susceptibility to human influenza viruses, ferret models have been recognized as a useful tool in studying respiratory viruses as they were found to resemble the human course of disease of a number of human respiratory viruses, such as respiratory syncytial virus, parainfluenza viruses, and SARS coronavirus^13-16. Particularly, the anatomic proportions of the ferret upper and lower respiratory tracts, the density of submucosal glands in the bronchial wall, and the number of generations of terminal bronchioles resemble the condition in the human respiratory tract¹⁵, further supporting the adequacy of ferrets as animal model to study human respiratory viral infection.

In order to address numerous critical scientific questions from basic virology to the development and assessment of novel drug and vaccine for COVID-19, we have recently established a ferret model for SARS-CoV-2 infection and transmission that highly recapitulates pathological aspects of the human infection¹⁷. SARS-CoV-2-infected ferrets exhibited elevated body temperatures, and virus replication was readily detected; infected ferrets shed the virus through nasal washes and in saliva, urine, and fecal specimens; SARS-CoV-2 was readily transmitted to naïve direct-contact ferrets but less efficiently to naïve indirect-contact ferrets; and acute bronchiolitis was observed in infected lungs¹⁷. To further explore the age-related disease severity observed in COVID-19 patients, we infected ferrets divided into three different age groups with SARS-CoV-2: ferrets under 6 months to mimic juvenile/children (G1), 1 to 2-year-old ferrets to mimic young adults (G2), and more than 3-years-old ferrets to mimic patients over 50 years old adults (G3). To compare the disease severity among these three groups, clinical symptoms, viral load in the respiratory tract, and lung histopathology were examined. Furthermore, RNA sequencing (RNA-seq) analysis was performed with the lung tissues from SARS-CoV-2-infected young adult or aged ferrets to compare the global and dynamic gene expression differences. As a result, aged (G3) ferret group showed higher viral load and more severe clinical symptoms than juvenile (G1) and young adult (G2) ferret groups, and expressed high levels of gene sets related to type I interferon (IFN), activated T cell, and M1 macrophage responses. Thus, SARS-CoV-2-infected aged ferrets considerably resemble COVID-19 aged patients with severe symptoms, demonstrating high feasibility as an animal model recapitulating the age-dependent disease state of COVID-19 to study the development of novel therapeutics and vaccines for the exact target group.

Clinical features of SARS-CoV-2 infection among ferrets of different ages

In order to elucidate the clinical manifestations by SARS-CoV-2 infection across age groups, ferrets (n=9/group) were inoculated with 10^5.8 of 50% tissue culture infective dose (TCID₅₀)/ml of NMC-nCoV02 strain through the intranasal (IN) route. While ferrets less than 6 months of age (G1) showed no increase in temperature, both the G2 (1-2 years old) and G3 (more than 3 years old) groups of SARS-CoV-2 infected ferrets showed elevated temperatures at 2-6 dpi, where the G3 group showed a prolonged elevated temperature even at 10 dpi (Fig. 1A). This trend was also associated with changes in bodyweight, where the G1 group showed less than 5% weight loss during the entire SARS-CoV-2 infection period, while the G2 and G3 groups showed a maximal 10% weight loss at 6 dpi, followed by a rapid recovery of the G2 group from 6 dpi but not the G3 group (Fig. 1B). To compare clinical manifestations of SARS-CoV-2 infection, we developed an arbitrary scoring method to describe clinical symptom (CS) values based on a 20-minute observation period of cough, rhinorrhea, and reduced activity. These CS values were compared among ferret groups as described in Table 1. The G2 and G3 groups showed the highest CS values of 4.5 and 4.17 at 4 dpi, respectively, while the G1 group showed a maximal CS value of 1 at 2 dpi before quickly recovering within 4 days, exhibiting a mild to asymptomatic infection (Table 1). Particularly, the G3 group showed a prolonged period of high CS value that lasted until 10 dpi. Collectively, these results revealed that aged ferrets exhibited more severe and persistent clinical features of SARS-CoV-2 infection compared to younger ferrets.

Comparison of viral titer and shedding period among different age groups of ferrets

To evaluate whether the clinical features seen in the ferret groups were associated with the degree of virus replication, we measured infectious viral titers from nasal washes (Fig. 1C, left panel). SARS-CoV-2 was isolated from all infected ferrets, regardless of their ages, from 2 to 6 dpi, whereas ferrets in the G2 and G3 groups continued to shed infectious virus until 8 dpi. Comparison of viral titers revealed that the G3 group showed significantly higher viral titers (3.5 to 4.9 TCID₅₀/ml) from 2 to 6 dpi than the G1 and G2 groups. While the G2 group showed higher viral titers at 2 dpi than the G1 group, comparable viral titers were observed thereafter. These results clearly demonstrate that aged ferrets (G3) shed higher amounts of infectious virus in nasal discharges for a longer period of time than younger ferrets.

Because gastrointestinal involvement has also been documented during coronavirus infections of animals and humans^18,19, we collected fecal specimens from the infected ferrets and performed qRT-PCR to assess SARS-CoV-2 viral loads and shedding periods from the intestines of ferrets of different ages (Fig. 1D). While viral RNAs were detected in fecal specimens of all three groups from 2 to 4 dpi, the G3 group showed the highest viral RNA copy number from 2 to 8 dpi, followed by the G2 group. On the other hand, the G1 group showed a small peak of viral RNA at 2 dpi that rapidly declined thereafter to an undetectable range at 6 dpi. To further evaluate the level of viral titer in respiratory organs of infected animals, three ferrets from each group were euthanized at both 3 and 5 dpi for measuring viral titers in the nasal turbinate and lungs. As expected, the G3 group showed the highest viral titers among the groups at a maximum of 5.2 TCID₅₀/g in nasal turbinate at 3 dpi, and the G2 group also showed significantly high viral titers compared with the G1 group (Fig. 1E). Consistently, the G3 group showed a significantly higher viral titer (2.6 TCID₅₀/g) in lung tissues compared with the G1 and G2 groups at 3 dpi (Fig. 1F). These results demonstrate that aged ferret group shows significantly higher SARS-CoV-2 titers in the respiratory tract compared to juvenile and young adult ferrets, correlating with the clinical disease severity.

Comparison of SARS-CoV-2 transmission in ferrets by age

As viral titers differed significantly among different age groups, naïve ferrets (n=3/group) were co-housed and placed in direct contact (DC) with infected ferrets two days after the primary infection to compare the transmission efficiency of SARS-CoV-2 (Fig. 1C, right panel). Virus was detectable from nasal washes of the DC ferrets as early as 3 days post-contact (dpc), and ferrets co-housed with G3 group showed the highest viral titers at all time points with the highest peak of 4.10 log₁₀ TCID₅₀/ml at 5 dpc. The DC ferrets co-housed with G2 and G3 groups shed infectious virus up to day 9 post-contact, whereas the DC ferrets exposed to G1 ferrets showed the lowest viral titers all throughout the co-housing period, reaching an undetectable range of infectious virus after 7 dpc (Fig. 1C, right panel). This showed that as the aged ferret group harbored high SARS-CoV-2 titers in their respiratory tracts, they were able to effectively transmit the virus to naïve ferrets by direct contact. As seen with children who are less infectious than adults infected with SARS-CoV-2 due to their mild clinical manifestation of disease²⁰, infected juvenile ferret group carried low virus titer and was not readily infectious to naïve ferrets upon direct contact.

Differential lung histopathology of infected ferrets of different ages

COVID-19 has most commonly been shown to be associated with a spectrum of lung damage. To compare lung histopathology among ferrets of different ages, an RNAscope in situ hybridization and histopathological examination were conducted (Fig. 2). RNAscope in situ hybridization results showed that the G1 juvenile ferrets of less than 6 months of age had minimum SARS-CoV-2 RNA-positive cells at both 3 and 5 dpi (Fig. 2A-D) with limited inflammatory regions (Fig. S1A-D). Although similar numbers of SARS-CoV-2 RNA-positive cells were detected between young adult G2 group and aged G3 group (Fig. 2E-H and I-L), the G2 group displayed only moderate lung pathological changes in comparison to the G1 group (Fig. S1E-H). On the contrary, lung histopathology of the G3 group revealed a higher severity of pathological features highlighted with increased inflammatory cell infiltration and alveolar septa being widened, edematous, and congested (Fig. S1I-L). These results demonstrate that the severity of lung damage is closely associated with the number of SARS-CoV-2 RNA-positive cells in the lungs.

Differential SARS-CoV-2 antibody neutralization titers among ferrets of different ages

To compare the serum neutralization antibody (NAb) titers among ferrets of different ages, blood was collected from each group of ferrets at 12 and 21 dpi. At 12 dpi, all tested ferrets showed NAb titers of 32-64 without significant differences among the groups. However, at 21 days, the NAb titers were at least four-fold higher in the G3 group (GMT 256) than in the G1 group (GMT 64) (Fig. 3A). Furthermore, the G3 group showed significantly increased NAb titers at 21 dpi compared to 12 dpi, suggesting a continuous activation of immune response as far as 21 dpi (Fig. 3B). This indicated that similar to severe COVID-19 patients, aged ferrets that showed severe clinical symptoms and high viral titers in the respiratory tract exhibited high serum NAb response.

Transcriptional profile of immune-related genes in lung tissues of SARS-CoV-2-infected ferrets

To gain a comprehensive understanding of the transcriptional profile among ferrets of different ages following SARS-CoV-2 infection, we performed RNA sequencing (RNA-seq) analysis of lung tissues from G1, G2, and G3 ferret groups at 2 and 5 dpi, and compared the results with those of non-infected middle-aged ferrets (control, n=3). We first analyzed the overall variation of the samples using principal component analysis (PCA). Distinct clusters were observed among G1, G2, and G3 groups at 2 dpi (filled circle, lll), which were also clearly separated from that of control ferrets (filled triangle, p) (Fig. 4A). Intriguingly, age-dependent clustering at 2 dpi was largely attributed to principal component (PC) 2, which, in majority, was composed of interferon-stimulated genes (ISGs), such as ISG15, IRF7, and OAS1 (Fig 4A, Table S1). These findings indicate that genes related to IFN responses were highly enriched in aged ferrets compared to juvenile ferrets during the early stage of SARS-CoV-2 infection (2 dpi). In contrast, samples at 5 dpi (open circle) did not display any particular clustering by age in PCA. This phenomenon could be explained by the recovery of some animals (one ferret in each of the G2 and G3 groups, and two ferrets in the G1 group) from SARS-CoV-2 infection, which clustered with the control group.

To gain deeper insights into the divergent immune responses of SARS-CoV-2-infected ferrets with age, we identified differentially expressed genes (DEGs) in each group (Table S2). Compared to non-infected control ferrets, a total of 104 genes, including a number of ISGs (MX1, MX2, ISG15, OAS1, OAS2, OAS3, OASL, and IFI44L), genes related to chemokines (CXCL10 and CXCL11), and interferon regulatory transcription factor (IRF7), were commonly upregulated in SARS-CoV-2 infected-ferrets at 2 dpi regardless of age (Fig. 4B). On the other hand, 70, 80, and 51 genes were uniquely upregulated in G1, G2, and G3 groups at 2 dpi, respectively. Notably, the DEGs that were specifically upregulated in the G3 group at 2 dpi included genes related to activation of the innate immune response (TLR7, CLEC4F, CSF3R, and S100A12) and initiation of the adaptive immune response (IL12B), whereas genes associated with tissue remodeling (MMP1, COL3A1, COL5A3, and COL11A2) were highly enriched in the G1 group at 2 dpi (Fig. 4B). At 5 dpi, various ISGs (IFI6, IFI44, and IFI44L) and innate immunity-associated genes (RSAD2, CLEC4G, and TRIM22) were commonly upregulated in all SARS-CoV-2 infected ferrets (Fig. S2A). In particular, genes related to activated T cell responses, including PDCD1, CD69, and IL7R, were markedly enriched in the G3 group compared to the G1 and G2 groups.

Gene Set Enrichment Analysis (GSEA) revealed that DEGs of the G3 aged group were highly enriched with gene sets related to anti-viral innate immune response as well as adaptive immune response (T cell activation) at 2 dpi (Fig. 4C). These immune activation features were maintained even at 5 dpi (Fig. S2B). In contrast, tissue remodeling related gene sets, such as trabecula formation, chondrocyte proliferation, and cornification were highly enriched in G1 juvenile group both at 2 and 5 dpi (Fig. 4C and Fig. S2B).

Furthermore, Gene Set Variation Analysis (GSVA) with public gene sets revealed that gene sets related to B cell response and T cell response were predominantly enriched in the aged group (G3) at 2 dpi, compared to the juvenile (G1) or the young adult (G2) ferrets (Fig. 4D), which is in agreement with a recent clinical study that showed stronger antibody and T cell responses in severe COVID-19 patients than mild patients^21,22. Moreover, other immune-related gene sets, including IFN response, macrophage activation, and NK cell activation, were also highly enriched in the aged group at 2 dpi (Fig. 4D). Notably, gene sets related to type I IFN responses and activated M1 macrophages were significantly enriched in aged ferrets at the earlier stage of SARS-CoV-2 infection (Fig. 4E), suggesting a marked activation of immune response-associated inflammation promptly followed by the initial infection in aged ferrets. Finally, we investigated whether the SARS-CoV-2-infected aged ferrets also reproduced the natural course of severe COVID-19 as seen in humans. As a result, the gene sets upregulated in postmortem lung tissue of a COVID-19 patients²³ or PBMCs from severe COVID-19 patients²⁴ were also highly enriched in aged ferrets (G3), especially at 2 dpi, compared to the juvenile (G1) and young adult (G2) ferrets (Fig. 4F and G). These transcriptional profiles of immune-related genes indicate that the SARS-CoV-2-infected ferret model reflects the immunological properties of age-dependent severe human cases of COVID-19.

SARS-CoV-2 has been imposing a devastated effect on our global community in various aspects of our lives. While effective vaccines will be available soon, the exact time that it could reach the entire general public is still not guaranteed in the nearest months. Many predict that although help is on the way, the chaos is expected to get much worse before it gets better, as thousands of people die every day and are separated from their families, pushing the national health-care system to the brink. Moreover, as part of the social distancing policy, student attendance in academic institutions is currently restricted in many countries and is being replaced with online classes. However, as recent studies have suggested that although children and young adult populations may predominantly exhibit asymptomatic SARS-CoV-2 infections with low pathogenicity, they may still be carriers of infectious viruses^25,26. In contrast, a majority of patients with severe morbidity and mortality are reportedly elderly people who have limited social activities compared to other age groups^27-29. In this study, we demonstrate the age-associated pathogenesis of SARS-CoV-2 infection using a ferret model. Comparison of clinical symptom values and virus load analysis showed that aged ferret model fully recapitulates clinical manifestations of COVID-19 in human (Table 1 and Fig. 1). According to recent reports of human patients with SARS-CoV-2 infection in China, aged and comorbid patients carry high virus loads and experience difficulty recovering from severe pneumonia, leading to high mortality³⁰. This finding is well in line with the results of infected ferrets of different ages. Specifically, aged ferrets showed significantly increased virus loads in their respiratory tracts and longer period of virus shedding compared to the juvenile and young adult ferrets. Moreover, RNAscope in situ hybridization clearly demonstrated higher number of SARS-CoV-2 RNA-positive lung cells and infiltrated inflammatory cells in the aged ferret group compared to the juvenile and young adult groups, which ultimately resulted in severe viral pathogenesis. Thus, SARS-CoV-2-infected aged ferrets considerably resemble the severity of pathogenesis of aged COVID-19 patients, making it a valuable animal model to understand age-dependent viral pathogenesis of SARS-CoV-2.

Although the kinetics of antibody development in SARS-CoV-2 infected-ferrets were comparable among all three groups at 12 dpi, NAb titers were two- and four-fold higher in the young adult and aged ferret groups, respectively, than in the juvenile group (Fig. 3). It is noteworthy that the aged ferret group, which demonstrated more severe clinical symptoms along with the highest viral loads in the respiratory tract, showed a four-fold increase in NAb titer at 21 dpi over that at 12 dpi, suggesting a close association between clinical outcomes and antibody production. This result is also in well agreement with a recent study³¹ reporting that SARS-CoV-2 serum neutralizing antibody levels were higher in severe SARS-CoV-2 patients than in asymptomatic or mild patients. Thus, SARS-CoV-2-infected aged ferrets can also be used to understand the immunological aspects of why patients with worse clinical classification have higher neutralizing antibody titer.

The role of juvenile group, defined as anyone under 18 years of age, in the spread of SARS-CoV-2 has not been fully defined. A recent study shows that children are not likely to be the source of SARS-CoV-2 transmission and outbreak, and thus, are minor drivers of the COVID-19 pandemic²⁰. While the juvenile group typically have the highest rates of influenza virus infection and are often considered to play a critical role in influenza virus spread, a number of studies have shown low rates of pediatric SARS-CoV-2 infection and transmission, as well as mild symptoms. This suggests that as the juvenile group exhibit mild clinical manifestation of disease, they are less infectious for SARS-CoV-2 transmission than adults exhibiting more severe symptoms. In support of this observation, infected juvenile ferret group carried low virus titer and was not readily infectious to naïve contact animals. This indicates that besides the aged ferrets, juvenile ferrets can also potentially be a useful animal model in understanding the important scientific aspects of the infrequent transmission of SARS-CoV-2 from children to other children or adults.

Recently, a transcriptome analysis study of COVID-19 patients has demonstrated the induction of robust type I IFN responses in severe COVID-19 patients compared to mild/moderate COVID-19 patients²⁴. Transcriptome analysis during the early stage of SARS-CoV-2 infection in ferrets also revealed enrichment of those genes involved in both innate and adaptive immune responses in aged ferrets compared to the juvenile and young adult ferrets. Notably, the gene sets related to type I IFN response and activated M1 macrophages were significantly enriched in SARS-CoV-2-infected aged ferrets at 2 dpi. Furthermore, infected aged ferrets also showed enrichment of genes expressed in tissues of patients with severe COVID-19, such as lung tissues of post-mortem COVID-19 patients and PBMCs from patients with severe COVID-19 symptoms^23,24. These results indicate that the SARS-CoV-2-infected aged ferrets not only mimic the clinical course of severe symptoms of COVID-19 patients, but also the corresponding alteration of transcriptional profiles. In addition, the aged ferrets demonstrated upregulation of genes related to early activation of adaptive immune response, including T cell and B cell responses, which was maintained up to 5 dpi. These findings may provide a clue to the mechanisms underlying the relatively weak SARS-CoV-2-specific T cell responses and attenuated neutralizing antibody activity observed in asymptomatic or mild COVID-19 patients³². Thus, this study provides fundamental information of in vivo gene expression dynamics of host immune response as seen in hyper-inflammatory responses provoked by severe SARS-CoV-2 infection in COVID-19 patients^24,33.

We have recently developed aged (≥4 years old, equivalent to 70 years old in human) ferret infection models for the emerging human severe fever with thrombocytopenia syndrome virus (SFTSV) that fully recapitulate human clinical manifestation³⁴. SFTSV infection exhibits a severe clinical manifestation and increased fatality rate in aged patients of 50 years and older. This age-dependent clinical manifestation was well represented in SFTSV-infected aged ferrets, evidenced with severe symptoms, such as high temperature, body weight loss, severe thrombocytopenia, and death. Similarly, our current study using aged ferrets also demonstrates the age-dependent pathogenesis of SARS-CoV-2 seen in human. Aged ferrets showed significantly higher virus loads, longer virus shedding, and more severe lung pathology compared to the juvenile and young adult ferrets. Moreover, these differences were closely associated with enhanced type I IFN responses and activated M1 macrophages, as well as hyper-inflammatory responses in aged ferrets. Taken together, this aged immune-competent ferret model demonstrates for the first time an age-dependent pathogenesis of SARS-CoV-2 infection, making it an invaluable animal model to understand the age-dependency of COVID-19 pathogenesis and the detailed underlying mechanism of asymptomatic infection in juvenile and young adults.

Study design for age-dependent pathogenesis in ferrets

SARS-CoV and SARS-CoV-2 antibody-free ferrets over 36 months (3 years ≤ Age, n=9), 12-24 months (1 ≤ Age ≤ 2 years, n=9), and under 6 months (Age ≤ 6 months, n=9) were infected through the intranasal (IN) route with the NMC-nCoV02 strain at a dose of 10^5.8 TCID₅₀ per ferret. Nasal washes and fecal specimens were collected every day for 10 days from each group of ferrets to measure viral titers. To measure the infectious live virus in the collected specimens, each sample was inoculated with Vero cells, which were then incubated for 4 days prior to virus isolation. To assess viral replication in various organs of ferrets following SARS-CoV-2 infection, ferrets (n=3/group) were sacrificed at 3 and 5 dpi to harvest their nasal turbinates and lung tissues with individual scissors to avoid cross-contamination.

Quantitative real-time RT-PCR (qRT-PCR) to detect SARS-CoV-2 RNA

To measure the viral titer in respiratory and gastrointestinal tracts, nasal washes and rectal swab samples collected from ferrets were suspended in cold phosphate-buffered saline (PBS) containing antibiotics (5% penicillin/streptomycin; Gibco). To measure the viral copy number, total RNA was extracted from the collected samples using RNeasy Mini® kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions. A cDNA synthesis kit (Omniscript Reverse Transcriptase; QIAGEN, Hilden, Germany) was used to synthesize single-strand cDNA from total viral RNA. To quantify viral RNA copy number, quantitative real-time RT-PCR (qRT-PCR) was performed for the partial E gene primer set: forward primer, SARS-CoV-2-E-forward, atgtactcattcgtttcggaagag; and reverse primer, SARS-CoV-2-E-reverse, ctagagttcctgatcttctggtctaa with the SYBR Green kit (iQTM SYBR Green supermix kit, Bio-Rad, Hercules, CA, USA). The number of viral RNA copies was calculated and compared to the number of copies of the standard control.

SARS-CoV-2 isolation

SARS-CoV-2 was isolated from serial nasal wash specimens of each ferret group by inoculating with Vero cells in DMEM (Sigma Aldrich) supplemented with 2% fetal bovine serum (Fisher Scientific), 1 mM L-glutamine (Thermo Fischer), 50 U/ml penicillin (Thermo Fischer), and 50 μg/ml streptomycin (Thermo Fischer). Briefly, specimens were centrifuged at 4ºC at 1200 rpm for 15 mins and the supernatants were incubated with Vero cells for 2 hours. Media (DMEM) was changed daily and cells were monitored for 4 days to examine the cytopathic effects (CPEs). To confirm virus isolation, we performed qRT-PCR on supernatants from infected cell cultures using S gene-specific primer sets [Forward (5’-3’): AGGGCAAACTGGAAAGATTGCTGA, Reverse (5’-3’): TCTGTG CAGTTAACATCCTGATAAAGAAC].

RNA-Sequencing

Total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. RNA quality was assessed with Agilent 2100 Bioanalyzer using an RNA 6000 Nano Chip (Agilent Technologies), and RNA was quantified using an ND-2000 Spectrophotometer (Thermo Fisher Scientific). Extracted RNAs were processed using the TruSeq Stranded mRNA Sample Prep Kit (Illumina) according to the manufacturer’s instructions. High-throughput sequencing was performed as paired-end 150 sequencing runs using NovaSeq 6000 (Illumina). Raw reads were assembled and low-quality reads were filtered using Cutadapt (version 2.8). Filtered reads were aligned on a reference genome downloaded from Ensembl (MusPutFur1.0, Accession number: GCF_000215625.1) using STAR (version 2.7.1a) and annotated with additive human ortholog genes from the human reference database (Biomart database, GRCh38). Gene counts were normalized to valid library size and the dimensional reduction was performed by principal components analysis (PCA) using the top 2 principal components (PCs) throughout the whole samples. Two-sided Wald test was performed to analyze the differentially expressed genes (DEGs) according to each condition with DESeq2 (version 1.26.0)³⁵. DEGs were determined according to cutoffs of a p-value < 0.05 and a log2 fold change > 0.5 for by day and > 1 for by age. To analyze functional profiles of each condition, gene set enrichment analysis (GSEA) was performed in Gene ontology: Biological process database (GO. BP) and specific public gene set using clusterProfiler (version 3.14.3)^36-38. To compare the gene set enrichment score for the specific gene sets, gene set variation analysis (GSVA) (version 1.34.0) was performed³⁹. To calculate the severe COVID-19 signature score, significantly upregulated genes in severe COVID-19 patients were used^23,24.

RNAscope in situ hybridization and pathology

SARS-CoV-2 RNA (Spike gene) was detected using the Spike-specific probe (Advanced Cell Diagnotics, Cat. # 848561) and visualized using RNAscope 2.5 HD Reagent Kit RED (Advanced Cell Diagnotics, Cat. # 322360). Lung tissue sections were fixed in 10% neutral-buffered formalin and embedded in paraffin, according to the manufacturer’s instructions, followed by counterstaining with Gill’s hematoxylin #1 (Polysciences, cat # 24242-1000). For pathological examination, the embedded tissues were sectioned and dried for three days at room temperature. Histopathological examination was conducted by haematoxylin and eosin (H&E) staining. Slides were viewed using Olympus IX 71 (Olympus, Tokyo, Japan) microscope with DP controller software to capture images.

Serologic assay

The neutralizing antibody (NAb) assay against SARS-CoV-2 was carried out using a micro-neutralization assay in Vero cells. Collected ferret serum specimens were inactivated at 56°C for 30 min. Initial 1:2 serum dilutions were made with the medium, and two-fold serial dilutions of all samples were made to a final serum dilution of 1:2 to 1:1024. For each well, 50 μL of serial diluted serum was mixed with 50 μL (equal volume) of 100 TCID₅₀ of SARS-CoV-2 and incubated at 37 °C for 1 h to neutralize the infectious virus. The mixtures were then transferred to the Vero cell monolayers. Vero cells were incubated at 37°C in 5% CO2 for 4 days and monitored for 50% reduction in cytopathic effect (CPE).

Ethics statement

All animal experiments were approved by the Medical Research Institute, a member of Laboratory Animal Research Center of Chungbuk National University (LARC) (approval number: CBNUA-1352-20-02) and were conducted in strict accordance and adherence to relevant policies regarding animal handling as mandated under the Guidelines for Animal Use and Care of the Korea Center for Disease Control (K-CDC). Viruses were handled in an enhanced biosafety level 3 (BSL3) containment laboratory as approved by the Korean Centers for Disease Control and Prevention (KCDC-14-3-07).

Acknowledgments

This work was supported by National research foundation of Korea (NRF-2020R1A5A2017476, 2020R1A2C3008339), Korea Research Institute of Bioscience and Biotechnology (KRIBB) Research Initiative Program (KGM9942011), and National Institute of Health (AI140705, AI140705S, and AI152190).

Author Contributions

Conceptualization: Y.I. Kim, K.M. Yu, J.U. Jung, Y.K. Choi

Investigation: Y.I. Kim, K.M. Yu, J.Y. Koh, E.H. Kim, S.M. Kim, E.J. Kim, M.A.B. Casel, R. Rollon, S.G. Jang, M.S. Song, S.J. Park, H. W. Jeong, E.G. Kim, Y.H. Choi, S.A. Lee, S.H. Park, J.U. Jung, Y.K. Choi

Writing: Y.I. Kim, K.M. Yu, J.Y. Koh, J.U. Jung, Y.K. Choi

Competing interests

The authors do not have any competing interests to declare.

1 Zhu, N. et al. A novel coronavirus from patients with pneumonia in China, 2019. New England Journal of Medicine (2020).

2 WHO. WHO Director-General's opening remarks at the media briefing on COVID-19-11 March 2020. World Health Organization (2020).

3 Ksiazek, T. G. et al. A novel coronavirus associated with severe acute respiratory syndrome. New England journal of medicine 348, 1953-1966 (2003).

4 Zaki, A. M., Van Boheemen, S., Bestebroer, T. M., Osterhaus, A. D. & Fouchier, R. A. Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia. New England Journal of Medicine 367, 1814-1820 (2012).

5 ECDC. COVID-19 situation update worldwide, as of 25 November 2020. (2020).

6 Wu, Z. & McGoogan, J. M. Characteristics of and important lessons from the coronavirus disease 2019 (COVID-19) outbreak in China: summary of a report of 72 314 cases from the Chinese Center for Disease Control and Prevention. Jama 323, 1239-1242 (2020).

7 Wang, D. et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus–infected pneumonia in Wuhan, China. Jama 323, 1061-1069 (2020).

8 De Wit, E., Van Doremalen, N., Falzarano, D. & Munster, V. J. SARS and MERS: recent insights into emerging coronaviruses. Nature Reviews Microbiology 14, 523 (2016).

9 Roberts, A. et al. Aged BALB/c mice as a model for increased severity of severe acute respiratory syndrome in elderly humans. Journal of virology 79, 5833-5838 (2005).

10 Lindenauer, P. K., Lagu, T., Shieh, M.-S., Pekow, P. S. & Rothberg, M. B. Association of diagnostic coding with trends in hospitalizations and mortality of patients with pneumonia, 2003-2009. Jama 307, 1405-1413 (2012).

11 Bao, L. et al. The pathogenicity of SARS-CoV-2 in hACE2 transgenic mice. BioRxiv (2020).

12 Sun, S.-H. et al. A mouse model of SARS-CoV-2 infection and pathogenesis. Cell Host & Microbe (2020).

13 Capraro, G. A., Johnson, J. B., Kock, N. D. & Parks, G. D. Virus growth and antibody responses following respiratory tract infection of ferrets and mice with WT and P/V mutants of the paramyxovirus Simian Virus 5. Virology 376, 416-428 (2008).

14 Chan, K. F. et al. Investigating viral interference between influenza A virus and human respiratory syncytial virus in a ferret model of infection. The Journal of infectious diseases 218, 406-417 (2018).

15 Enkirch, T. & Von Messling, V. Ferret models of viral pathogenesis. Virology 479, 259-270 (2015).

16 Park, S.-J. et al. Altered virulence of Highly Pathogenic Avian Influenza (HPAI) H5N8 reassortant viruses in mammalian models. Virulence, 1-17 (2017).

17 Kim, Y.-I. et al. Infection and Rapid Transmission of SARS-CoV-2 in Ferrets. Cell host & microbe (2020).

18 Gu, J., Han, B. & Wang, J. COVID-19: gastrointestinal manifestations and potential fecal–oral transmission. Gastroenterology 158, 1518-1519 (2020).

19 Samanta, J., Dhar, J., Khaliq, A. & Kochhar, R. 2019 Novel Coronavirus Infection: Gastrointestinal Manifestations. Journal of Digestive Endoscopy 11, 13 (2020).

20 Zhu, Y. et al. A meta-analysis on the role of children in SARS-CoV-2 in household transmission clusters. Clinical Infectious Diseases (2020).

21 Chen, X. et al. Disease severity dictates SARS-CoV-2-specific neutralizing antibody responses in COVID-19. Signal transduction and targeted therapy 5, 1-6 (2020).

22 Peng, Y. et al. Broad and strong memory CD4+ and CD8+ T cells induced by SARS-CoV-2 in UK convalescent individuals following COVID-19. Nature immunology 21, 1336-1345 (2020).

23 Blanco-Melo, D. et al. Imbalanced host response to SARS-CoV-2 drives development of COVID-19. Cell (2020).

24 Lee, J. S. et al. Immunophenotyping of COVID-19 and influenza highlights the role of type I interferons in development of severe COVID-19. Science immunology 5 (2020).

25 Cai, J. et al. A Case Series of children with 2019 novel coronavirus infection: clinical and epidemiological features. Clinical Infectious Diseases (2020).

26 DeBiasi, R. L. et al. Severe COVID-19 in children and young adults in the Washington, DC metropolitan region. The Journal of Pediatrics (2020).

27 Chen, N. et al. Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study. The Lancet 395, 507-513 (2020).

28 Cui, Y. et al. A 55-Day-Old Female Infant infected with COVID 19: presenting with pneumonia, liver injury, and heart damage. The Journal of infectious diseases (2020).

29 Onder, G., Rezza, G. & Brusaferro, S. Case-fatality rate and characteristics of patients dying in relation to COVID-19 in Italy. Jama 323, 1775-1776 (2020).

30 Guan, W.-j. et al. Comorbidity and its impact on 1590 patients with Covid-19 in China: A Nationwide Analysis. European Respiratory Journal 55 (2020).

31 Okba, N. M. et al. Severe acute respiratory syndrome coronavirus 2− specific antibody responses in coronavirus disease patients. Emerging infectious diseases 26, 1478-1488 (2020).

32 Long, Q.-X. et al. Clinical and immunological assessment of asymptomatic SARS-CoV-2 infections. Nature medicine 26, 1200-1204 (2020).

33 Park, S. H. et al. Type I interferons and the cytokine TNF cooperatively reprogram the macrophage epigenome to promote inflammatory activation. Nature immunology 18, 1104 (2017).

34 Park, S.-J. et al. Ferret animal model of severe fever with thrombocytopenia syndrome phlebovirus for human lethal infection and pathogenesis. Nature microbiology 4, 438 (2019).

35 Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome biology 15, 550 (2014).

36 Ashburner, M. et al. Gene ontology: tool for the unification of biology. Nature genetics 25, 25-29 (2000).

37 Consortium, G. O. The gene ontology resource: 20 years and still GOing strong. Nucleic acids research 47, D330-D338 (2019).

38 Liao, M. et al. Single-cell landscape of bronchoalveolar immune cells in patients with COVID-19. Nature medicine, 1-3 (2020).

39 Hänzelmann, S., Castelo, R. & Guinney, J. GSVA: gene set variation analysis for microarray and RNA-seq data. BMC bioinformatics 14, 7 (2013).

Table 1 is available in the Supplementary Files

There is NO Competing Interest.

Table1.pdf
Table 1
FigureS1.pdf
Supplementary Fig. 1. Histopathology of lungs from SARS-CoV-2 infected ferret groups. Ferrets were inoculated with 105.8 TCID50 of NMC-nCoV02 virus. Lung tissues were harvested on days 3 and 5 post-inoculation. Histopathological lung regions were compared among the different age groups of ferrets: (A-D) juvenile (less than 6 months, G1 group), (E-H) young adults (1 to 2 years, G2 group), and (I-L) aged ferrets (older than 3 years). Magnification x40 and scale bar 200µm (A, C, E, G, I, and K). Magnification x100 and scale bar 100µm (B, D, F, H, J, and L).
TableS1.pdf
Table S1
TableS2.pdf
Table S2

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Age-dependent pathogenic characteristics of SARS-CoV-2 infection in ferrets

Archived Versions:

Version 1

Abstract

Figures

Introduction

Results

Discussion

Methods

Declarations

References

Table

Additional Declarations

Supplementary Files

Archived Versions:

Version 1