Cell culture
MC3T3-E1 cells were maintained in high glucose medium (HyClone, Logan, USA) supplemented with 10% (v/v) fetal bovine serum (FBS; BBI, Shanghai, China), 100 U/ml penicillin and 100 µg /ml streptomycin (HyClone, Logan, USA) and cultured with 5% CO2 at 37°C. For osteogenic differentiation, the cells were cultured in high glucose medium supplemented with 5% FBS, 100 U/ml penicillin, 100 µg /ml streptomycin, 10−8 mol/L dexamethasone (Sigma, St, Louis, MO) and 10 mmol/L β-glycerophosphate (Solarbio, Beijing, China). The medium was replaced every two days.
Referring to the past researches, EphrinB2-fc (Sino Biological, Beijing, China) was used to stimulate ephrinB2-Ephb4 signaling in the MC3T3-E1 cells at a concentration of 4 µg/ml 36,37. NVP-BHG712 (Selleck, Shanghai, China) was used to inhibit Ephb4 signaling, and we used it at a concentration of 200 nM 38.
Application of TF in vitro
MC3T3-E1 cells were seeded onto plastic cell culture plates (Miri Technology, Chengdu, China) at a density of 1 × 105 per dish and cultured in normal culture medium in cell culture dishes (Figure 1a1), cells grew adherently on the plastic plates. For TF stimulation, the plastic plates were transferred to the tensile force dish (Figure 1a2), and the four-point bending force device system (Sichuan University, Chengdu, China) was used to apply TF to the cells on the plastic plates (Figure 1a3-a4). The TF applied to the cells was 2000 µε (µε is defined as deformation, with 1000 µε corresponding to 0.1% deformation). The schematic diagram of applying TF is shown in the figure 1b.
Cell Counting Kit-8 and Live/Dead staining
MC3T3-E1 cells were inoculated onto cell culture dishes (bottoms were covered by plastic plates) at a density of 1 × 105 per dish, TF stimulation was loaded on cells for 0 h, 2 h, 6 h and 12 h respectively, then digested cells with trypsin, seeded them in a 96-well plate at a density of 5000 cells per well, and culture for 24 hours at 37°C. At the time point of 24h, 10 µl Cell Counting Kit reagent (New Semi Biotechnology, Suzhou, China) was added to each well and incubated at 37°C for 1-2 h, and then a microplate reader was used to measure the absorbance at 450 nm.
MC3T3-E1 cells were stimulated by TF for 0 h, 2 h, 6 h and 12 h respectively, then digested cells with trypsin, seeded them in a 96-well plate at a density of 5000 cells per well, and the cells were incubated at 37°C for 24 h. At the time point of 24h, 200 µl AM/PI was added to the wells and incubated at 37°C in the dark for 15 minutes, then a fluorescence microscope was used for observation.
ALP staining
The MC3T3-E1 cells were cultured by the osteogenic induction medium and stimulated by TF for 0 h, 2 h, 6 h or 12 h at each day, after 7 days, 4% paraformaldehyde (PFA) was used to fix cells and an ALP staining kit (Beyotime Biotechnology, Shanghai, China) was used to stain cells. Following staining, cells were visualized by a microscope.
Quantitative real-time reverse-transcriptase polymerase chain reaction assay (qPCR)
After stimulated by TF, total mRNA in the MC3T3-E1 cells was extracted using an RNA extraction kit (Forge Biotechnology, Chengdu, China) according to the manufacturer’s instructions and reverse transcribed using a transcription kit (CWBIO Biotechnology, Beijing, China). QPCR was performed using a SYBR kit (CWBIO Biotechnology, Beijing, China). Each sample was prepared in triplicate, and each experiment was repeated at least 3 times. GAPDH was used as control. The sequences of the primers for mouse RUNX2, OPN, Ephb4 and GAPDH are shown in Table 1. The relative gene expression levels were calculated using the 2−ΔΔCT method.
Primer sequences
Gene | Primer sequence(5’-3’) |
EphB4 | F:GCGGAAAGCAACAAAGTA |
| R:CGGCAGCGTACAGCATAAGT |
RUNX2 | F:CCTTCAAGGTTGTAGCCCTC |
| R:GGAGTAGTTCTCATCATTCCCG |
OPN | F:AAACACACAGACTTGAGCATTC |
| R:TTAGGGTCTAGGACTAGCTTGT |
GAPDH | F: AGGTCGGTGTGAACGGATTTG |
| R:TGTAGACCATGTAGTTGAGGTCA |
Table1. Primer sequences for qPCR. |
Western blotting
After stimulated by TF, proteins were extracted from MC3T3-E1 cells using RIPA buffer (Beyotime Biotechnology, Shanghai, China) containing 1% phenylmethylsulfonyl fluoride (PMSF; Beyotime Biotechnology, Shanghai, China) for 30 min, and the protein concentrations were measured using a bicinchoninic acid (BCA; New Semi Biotechnology, Suzhou, China) protein assay kit. Then, the protein samples were mixed with 5 × loading buffer (CWBIO Biotechnology, Beijing, China) and heated at 100°C for 10 minutes. The samples were then separated on 12.5% SDS–PAGE gels and transferred to nitrocellulose membranes for 90 min at 200 V. The membranes were subsequently blocked with 5% bovine serum albumin (BSA) for 1 h at 4°C and incubated with primary antibodies at 4°C overnight. The anti-mouse primary antibodies used in this study were as follows: RUNX2 (1:1000, catalog no. 12556S; CST), OPN (1:1000, catalog no. A19092; ABclonal), EphB4 (1:1000, catalog no. ab266733; Abcam), ERK1/2 (1:1000, catalog no. 4695S; CST), p-ERK1/2 (1:1000, catalog no. 4370S; CST), P38 (1:1000, catalog no. 8690; CST), p-P38 (1:1000, catalog no. 4511; CST), JNK1/2/3 (1:1000, catalog no. 9252; CST), p-JNK1/2/3 (1:1000, catalog no. 4668; CST) and GAPDH (1:1000, catalog no. AF1186; New Semi Biotechnology). After being washed with Tris-buffered saline containing 0.05% Tween-20 (0.05% TBST buffer), the membrane was incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (1:5000, catalog no. A0208; Beyotime Biotechnology) for 1 h at 4°C. Protein bands were visualized using enhanced chemiluminescence (ECL; New Semi Biotechnology, Suzhou, China), and the band intensities were analyzed by ImageJ (Fujifilm, Tokyo, Japan).
Establishment of a rat OTM model
25 SD male rats aged 6 weeks (200-220 g) were used to establish rat OTM models, all animal procedures were approved by the Experimental Animal Welfare Ethics Committee of Jilin University (KT202003139). This study was conducted in accordance with ARRIVE guidelines. The animal experiments were performed using a previously described method 39,40, nickel-titanium tensile springs were used to connect the incisors and first molars of maxillary (Figure 4a), TF of the spring was 50g and the treatment lasted for 7 days. The rats were randomly divided into 4 groups (5 rats/ group): OTM group (OTM treated, injected PBS 20 µl /day), ephrinB2-fc group (OTM treated, injected ephrinB2-fc 2mg/kg/day in 20 µl), NVP-BHG712 group (OTM treated, injected NVP-BHG712 5mg/kg/day in 20 µl), ephrinB2-fc+NVP-BHG712 group (OTM treated, injected ephrinb2-fc 2mg/kg/day in 10 µl and NVP-BHG712 5mg/kg/day in 10 µl). Rats were given local injection once a day, the site of administration was on the surface of the mesial and distal alveolar bone of the maxillary first molar, 10 µl medicine was injected at each side. On the 7th day, all rats were euthanized, and the upper jaw were dissected and fixed in 4% paraformaldehyde (PFA) for 24 hours.
Micro CT
Micro CT (HiScan XM Micro CT) was used to scan the rats’ maxillary alveolar bones. The scanning parameters were as follows: 80 kV, 100 µA, single exposure time 50 ms, scanning resolution 25 µm, scanning interval 0.5 degrees. The AMIRA software was used to reconstruct and analysis. The distance between the first molar and second molar was represented the tooth moving distance. The alveolar bone on the distal side of the first molar was selected as the region of interest (ROI), and the trabecular bone parameters were measured. The main measurement parameters were bone volume fraction (BV/TV), bone trabecular thickness (Tb. Th.), and bone trabecular separation (Tb. Sp.).
Hematoxylin-eosin (H&E) staining
The samples fixed with 4% PFA were decalcified in 10% ethylenediamine tetraacetic acid (EDTA) for 12 weeks. After dehydration with an ethanol gradient, the samples were embedded in paraffin and sectioned at a thickness of 3 µm. The sections were stained with hematoxylin-eosin (H&E) staining solution and observed under a microscope.
Statistical analysis
The data are expressed as the mean ± standard deviation. Comparisons between two groups were performed with the two-way t tests, and comparisons among multiple groups were performed with one-way ANOVA followed by Bonferroni post hoc tests. P values <0.05 were considered significant.