Nanoparticles and Reagents
The commercially available ZnO nanopowders (ZnO NPs), with manufacturer’s reported average size 20 nm (99.5% purity, nearly spherical) and 90-200 nm (99.9% purity, irregular morphology), were purchasedfrom Nanostructured & Amorphous Materials (Houston, TX). Except for otherwise noted, all the reagents and chemicals used in this study were purchased from Sigma-Aldrich (Shanghai, China).
Nanoparticle Dispersion, Aging and Characterization
ZnO NPs stock suspensions (1 mg/mL) were prepared by suspending dry nanopowders in Milli-Q H2O (Millipore, 18 MΩ•cm), and sterilized by autoclaving (120°C, 30 min), then stored at 25°C for natural aging period ranging from 0 to 60 days. The 0-and 60-days’ naturally transformed ZnO NPs were designated as fresh and aged NPs, respectively. To ensure proper dispersion, the fresh and aged suspensions were sonicated (100 W) for 30 min in an ultrasonic bath before characterization or incubation with cells. The morphology, particle size and aggregation of fresh and aged ZnO NPs were characterized by using transmission electron microscopy (TEM, JEOL JEM-2010, Tokyo, Japan). The crystal structure of fresh and aged ZnO NPs were determined using power X-ray diffraction (XRD, PANalytical B. V., Shanghai, China) by comparing to authentic standards.The details of natural aging process and characterization on ZnO NPs have been described previously [19].
Cell Culture and Treatment with ZnO NPs
AL cell line, a kind of human-hamster hybrid cells formed by fusion of the gly2A mutant of Chinese hamster ovary (CHO) and human fibroblasts, was used in this study. These hybrid cells contained a standard set of CHO-K1 chromosomes and a single copy of human chromosome 11 , and were cultured in Ham’s F12 medium (Hyclone, Grand Island, NY) supplemented with fetal bovine serum (8%, Hyclone, Grand Island, NY), gentamicin (25g/mL) and glycine (2×10-4M) at 37°C in a humidified 5% CO2 incubator [20].The stock suspensions of fresh and aged ZnO NPs were dispersed b y30 min of ultrasonication (100W) to prevent agglomeration, subsequently diluted to appropriate concentrations with cell culturemedia for the exposure of cells. Cells maintained in cell culture media without NPs were served as control in each experiment.
Assay for Detecting the Cytotoxicity
AL cells at a logarithmic phase of growth were cultured on glass slides in 35-mm Petri dishes (6 × 104 cells/dish) for 24 h before stimulation, followed by treatment with 2 mL of culture medium containing 1, 5, 10, 12, 15 and 20 µg/mL fresh or aged ZnO NPs 72 h. After the completion of treatment time, the images of cell morphology were obtained using a Leica DM4B microscope (Leica, Germany). ZnCl2 was included as zinc ions reference for comparing the cytotoxicity with ZnO NPs.
The cell counting kit (CCK)-8 (APExBIO, Shanghai, China) was used for detecting the cell viability. In details, AL cells were seeded into 96-well plates (4 × 10 3cells/well) with cell culture media for 24 h, and treated with medium containing various concentrations of ZnCl2, fresh and aged ZnO NPs for 24, 48 and 72 h, respectively. For working solution, the volume of added NPs from the stock suspension was less than 5% of the total volume of the culture medium in each well. After the completion of treatment time, the culture medium was aspirated, and the cells were incubated with 100 µL CCK-8 working solution for 2 h at 37°C following the manufacturer’s instructions. Then, the absorbance was recorded at 450 nm using a Spetra Max M2 fluorescence reader (Molecular Devices, Wokingham, Berks, UK).Cell viability was calculated as a percentage of absorbance in wells, with each concentration of NPs normalized to the absorbance of control cells (100%).
RNA Extraction, Reverse Transcription and Quantitative PCR
AL cells at a logarithmic phase of growth were seeded into 35-mm diameter Petri dish (6 × 104 cells/dish) with cell culture media for 24 h. Then the medium was replaced with 2 mL of culture medium containing 12 µg/mL ZnCl2, fresh and aged ZnO NPs for 72 h. After the completion of treatment time, the culture medium was aspirated, and cells were washed 3 times with PBS. Subsequently, 1mL of Trizol reagent (Invitrogen, Carlsbad, CA, USA) was added to each dish to extract total RNA according to the manufacturer’s instructions. Concentration and purity of total RNA obtained after the extraction were quantified usinga Q5000UV-Vis Spectrophotometer (Quawell, USA). After quantification, reverse transcription was performed using TransGene RT-PCR kit (TransGene Biotech, Beijing, China)to obtain cDNA from the RNA template according to the manufacturer’s protocols.The resulting cDNA samples were quantified by usingthe Q5000 UV-Vis Spectrophotometer, and then analyzed using SYBR-Green as fluorescence dye (TransGene Biotech, Beijing, China) on Roche RT-PCR system (Applied Biosystems).
The housekeeping gene encoding Glyceraldehyde-3-phosphate Dehydrogenase (GAPDH) was used as internal control for evaluating Il-1α, Il-1β, Caspase 3, CD69, Jun and MT1 mRNA expression. The results were expressed as the relative expression ratio between the targeted gene and Gapdh. The primer sequences used in this study are provided in Table 1.
Table 1
Primers used in this study
Name
|
Primer
|
Sequence
|
Length (bp)
|
Il-1α
|
Forward
|
5’ CGTCCGTCGTAATATCAG 3’
|
178
|
|
Reverse
|
5’GACTTCATGGGACGATATG3’
|
|
Il-1β
|
Forward
|
5’ ACCTTCCAGGATGAGGACATGA3’
|
121
|
|
Reverse
|
5’CTAATGGGAACGTCACACACCA3’
|
|
Caspase 3
|
Forward
|
5’CACATGTTCTCTGGGAAATCG3’
|
162
|
|
Reverse
|
5’ TTGTATCTCTGGAAGTTTCAGATTGTT3’
|
|
CD69
|
Forward
|
5’GCCACCACGCTCTTCTGTCTAC3’
|
163
|
|
Reverse
|
5’ GGGTCTGGGCCATAGAACTGAT 3’
|
|
Jun
|
Forward
|
5’CACATGTTCTCTGGGAAATCG3’
|
177
|
|
Reverse
|
5’ TTGTATCTCTGGAAGTTTCAGATTGTT3’
|
|
MT1
|
Forward
|
5’GCCACCACGCTCTTCTGTCTAC3’
|
126
|
|
Reverse
|
5’ GGGTCTGGGCCATAGAACTGAT 3’
|
|
Gapdh
|
Forward
|
5’GTTAAGCAGTACAGCCCCAAA3’
|
123
|
|
Reverse
|
5’ AGGGCATATCCAACAACAAACTT3’
|
|
RNA Sequencing Data Analysis
The total RNA samples of ALcells from control group, aged ZnO NP- treated group, and ZnCl2 treated group were sequenced by BangFei Bioscience (Beijing, China). Briefly, the total RNA of AL cells was extracted following the TRIZOL protocols, until the isoproponal precipitation. Then the RNA samples were resuspended in the extraction buffer before sequencing.The raw count RNA sequencing data was analyzed using R package Deseq2 [Eric1]. The venn diagram was generated by R package Venn Diagram [Eric1.2]. The significantly changed genes were used for further pathway enrichment analysis. Experiments were done three independent replicates. rRNA genes, mitochondrial genes and the genes detected less than 40 bp were excluded from the analysis.
The RNA sequencing data, reference series GSE97852, GSE60159, and GSE39444, were obtained from Gene Expression Omnibus [Eric2, 3, 4]. The Gene Set Enrichment Analysis plot was generated by R (version 3.6.2) using package fgsea [Eric5]. The apoptosis genes with 1.5-fold significant change & p value < 0.05 were used for further analysis. The heatmap with gene tree was generated by R package “Complex Heatmap” [Eric6]. Average linkage was used as the clustering method and Euclidean was used as a distance measurement method. The pathway enrichment analysis was preceded using STRING2.0 [Eric7].
Western Blotting
AL cells at a logarithmic phase of growth were seeded into 60-mm diameter Petri dish (1.5 × 105 cells/dish) with cell culture media for 24 h. Then the medium was replaced with 4 mL of culture medium containing 12 µg/mL fresh or aged ZnO NPs for 24 h. At the end of exposure period, the culture medium was aspirated, and then cells were washed 3 times with PBS and lysed on ice with RIPA lysis buffer (Beyotime, China) to collect cellular proteins. Equal amounts of cellular proteins were separated on 12% SDS-PAGE gels, and then transferred to a polyvinylidene fluoride (PVDF) membrane (Roche, Swiss). Briefly, after 2 h blocking with 5% nonfat milk in TBST at 25°C, the membranes were subsequently incubated with primary antibody at appropriate dilutions (according to the manufacturer’s protocols) at 4°C overnight, followed by incubating with HRP-conjugated secondary antibodies (1:5000, Promega, Madison, USA) for 2 h at 25°C.Finally, immunolabeling was detected using an enhanced chemiluminescence (ECL) (BOSTER, China) solution.The primary antibodies of anti-pro/cleaved Caspase-3 and anti-Actin were purchased from Cell Signaling Technology and ImmunoWay, respectively.
Statistics
Statistical analysis was compiled on the means ofthe results obtained from at least three independent experiments. All Data were presented as means ± standard deviation (SD), and statistically compared using one-way analysis of variance (ANOVA). In all plots p values< 0.05 were showed as * and considered to be statistically significant.