Bio-informatics analysis
The Phytozome (https://phytozome.jgi.doe.gov/pz/portal.html#!search?show=BLAST) BLAST tool was used to identify sequences orthologous to the human ARF4 sequence. The SUMOylation sites and the SUMO interaction motif (SIM) were predicted with SUMOplot (http://www.abcepta.com/sumoplot) and GPS-SUMO (http://sumosp.biocuckoo.org/online.php) (33, 34). Clustal W was used for multiple sequence alignment and edited with the BioEdit tool (35). The protein-protein interaction network was predicted using STRING (string-db.org/) and was edited and analyzed with the Cytoscape_3.7.2 (36).
Constructs used and site directed mutagenesis
ChR1Ct (960-2136 bp) and ChR2Ct (945-2211 bp) cloned in the pETSUMO vector (Champion pET SUMO Expression System, Thermo Fisher Scientific) were provided by Dr. Mayanka Awasthi. The CrARL11GST fused construct cloned in pGEX4T1 was provided by Dr. Peeyush Ranjan. ChR1Ct was mutated at V643XP645X site to M643XS645X and ChR2Ct at V628XP630X site to M628XS630X using QuickChange II Site-Directed Mutagenesis kit, Agilent. SDM-PCR cycling parameters were adjusted according to the instruction of manual. The sequence of the primers used for SDM are as follows:
ChR1CtV643M;P645S Fw: CATGCAGGCCATGGGTGGCATGATGTCCAGCCCCGCCCCC, Rev: GGGGGCGGGGCTGGACATCATGCCACCCATGGCCTGCATG and
ChR2CtV628M;P630S Fw: ATGAGCTCCGGCGTGGTGGCCAACATGACGTCCTCCGCCG
Rev: CGGCGGAGGGCGTCACGTTGGCCACCACGCCGGAGCTCAT.
Chlamydomonas reinhardtii cell culture
Chlamydomonas reinhardtii wild type strain CC-124 was procured from Chlamydomonas resource center (www.chlamycollection.org). Culture was grown using TAP (tris-acetate-phosphate media, pH 7.4 and supplemented with Hutner trace elements) at 25 ˚C in a shaker incubator (120 rpm) in a light synchronized manner (14 hrs light and 10 hrs dark condition). Light exposure was provided using white fluorescent light (2300 lux).
Preparation of Chlamydomonas total cell lysate (CrTCL) under different experimental conditions and immunoblotting
The total cell lysate of C. reinhardtii culture (CC-124 strain) was prepared using exponential phase cells that were harvested by centrifugation at 5000 rpm for 5 min. The cell pellet was resuspended in 10 ml of 1X TBS (50mM Tris-Cl pH 8.0, 150mM NaCl) supplemented with 1 mM PMSF and recommended amount of protease inhibitor cocktail (Protease inhibitor cocktail, for plant cell extracts, Sigma Aldrich) in the presence or absence of 20 mM n-ethylmaleimide (NEM, Cat. No. E3876, Sigma Aldrich), as required for the SUMOylation detection experiments. NEM has been used for the detection of SUMO conjugated proteins in C. reinhardtii as described earlier (37, 38). The cell suspension was homogenized using the following sonication parameters: 35% amplitude, 8 sec. ON/OFF cycle lasting for 3 min. After sonication, the concentration of protein in the CrTCL was estimated by the Bradford assay. CrTCL was also incubated with a purified ULP-1 enzyme (Concentration: 8µg/µl) preparation as per the mentioned experimental design: Different concentrations of the ULP-1 enzyme (1:100, 1:500 and 1:1000) were incubated with 30 µg of CrTCL in the absence or presence of NEM. The reaction was incubated at two temperatures, 22°C (Optimal temperature for growth of C. reinhardtii cells) for 2 hrs and 37°C for 1 hr. Finally, samples were solubilized in standard 2X Laemmli buffer and subsequently analyzed with SDS-PAGE. Then, western blotting using ChR1Ct or SUMO antibody, was done according the protocol established earlier (17).
Co-immunoprecipitation (Co-IP) and Nano LC-MS/MS
C. reinhardtii cells were harvested in their exponential phase (O.D.700: 0.6-0.7) and resuspended in IP lysis buffer [50 mM Tris-Cl pH 8.0, 150 mM NaCl, 0.5% Sodium deoxycholate, 1% NP-40, 1 mM PMSF (added freshly), and PIC (Protease inhibitor cocktail)] in the presence or absence of 20 mM NEM. Sonication was performed for 3 min. (8 sec. ON/OFF cycle with 35% amplitude) to homogenize the algal cells and cell debris was removed by centrifugation at 14000 rpm for 10 min. The supernatant from the previous spin was precleared with pre-immune serum (rabbit) along with protein A beads (Protein A Sepharose beads, Invitrogen, USA). 1 ml of the precleared lysate was then incubated overnight at 4°C with 1 µg/ml of primary antibody with end to end rotation. The treated lysate was then incubated with 25 µl protein A Sepharose beads for 2 hours at 4°C with rotation. After removing the CrTCL supernatant, the antibody-antigen complex bound beads were washed once with 1X PBS and 3 times with IP lysis buffer. For Nano-LC-MS/MS analysis, the complex was eluted from the bound protein A beads with 0.1 M glycine, pH 2.8 (pre-sterilized with 0.2-micron filter), which were then neutralized with 1 M Tris-Cl pH 8.0. The elutions were then solubilized in a buffer containing 6 M guanidinium hydrochloride and 50 mM ammonium bicarbonate. The reduction and alkylation were done with 10 mM Tris(2-carboxyethyl) phosphine hydrochloride (TCEP) and 55 mM iodoacetamide (IAA) in 25 mM ammonium bicarbonate, respectively. These samples were trypsinized overnight and then desalted. After speed vac, these samples were resuspended in 0.1% formic acid and loaded on C18 reverse phase column (Central Instrument Facility, UDSC). Raw data was then analyzed using the Proteome Discoverer 2.2 (Thermo Scientific, USA). For detecting co-immunoprecipitation of a specific protein in the IP elution using immunoblotting, the protein-antibody complex was eluted from the beads by directly adding 2X Laemmli buffer and heating at 95°C for 10 min. Western blotting was done with the protein specific antibody (annotation and dilution of antibody have been provided in the respective Fig. legend).
Expression and purification of the recombinant proteins
Expression constructs containing the target genes (ChR1Ct, ChR2Ct, CrARL11GST, ChR1CtVP mutant, GST Only) were transformed into E. coli strain BL21 (DE3λ). Luria-Bertani broth (LB) was supplemented with 50 µg/ml of kanamycin (for pET-Sumo constructs) or 100 µg/ml ampicillin (for pGEX4T1 constructs), during bacterial cultivation. Cultures were incubated overnight at 37°C with shaking at 200 rpm. The culture was then scaled up (secondary culture) using the overnight grown primary culture, in TB media (Terrific Broth) with appropriate antibiotic, incubated at 37°C with shaking till an O.D600 of 0.6-0.8 was attained. Flasks were incubated on ice for 45 minutes prior to induction. Recombinant protein expression was induced with 0.3 mM IPTG (Isopropyl β-D-1-thiogalactopyranoside) at 16°C with shaking at 200 rpm. Cells were harvested after 48 hrs of induction by centrifugation at 6000 rpm for 10 min. and further resuspended in 1XPBS containing 50 µg/ml lysozyme and 200 µM PMSF. The solubilized cell were homogenized by sonication at 35% amplitude and 30 sec. ON/OFF pulse for 5 min. Lysed cells were then centrifuged at 12000 rpm for 55 min. The total cell lysate was separated into soluble and insoluble fraction. The soluble fraction, containing the protein of interest, was filtered using a 0.45 µm filter. The protein with a histidine (His)-tag (in case of pET-SUMO based constructs) was purified using a Co2+ immobilized talon beads column (TALON® Metal Affinity Resins, Clontech Laboratories, Inc., USA) by immobilized metal ion affinity chromatography (IMAC). Protein with a GST tag (for pGEX-4T1 based constructs) was purified using Glutathione Sepharose beads 4 Fast Flow (GE Healthcare, USA). The protein of interest was eluted with 250 mM Imidazole (Fisher Scientific, USA) in case of Co2+ immobilized talon beads. The GST beads bound protein complex was eluted with 30 mM reduced glutathione solubilized in 50 mM Tris-Cl pH 8.5 [Glutathione reduced (GSH), SRL].
GST pull-down assay
Recombinant protein of CrARL11GST, GST only, ChR1Ct, ChR2Ct and ChR1CtVP mutant variants were expressed into E. coli strain BL21 (DE3λ). Cells were pelleted, homogenized and fractionated by centrifugation as described in the previous section of materials and methods. GST beads bound CrARL11GST was used as a bait to pull down ChR1Ct, ChR2Ct and ChR1CtVP mutant variants (prey for the experiment) from their respective soluble fractions. GST protein was used as a negative control during this experiment. For the pull down, 1 ml soluble fractions of the prey protein(s) were first precleared with 20 µg GST protein and 20 µl glutathione Sepharose beads. Soluble fraction was then spun at 13000 rpm, 4°C and the supernatant was taken for GST pull-down assay. Each prey protein was incubated with glutathione Sepharose beads bound to 20 µg GST as negative control and to 20µg ARL11GST, separately, for 1hr at 4°C with end-to-end mixing. Beads were washed 3 times with chilled 1XPBS. Bound proteins were eluted with GST elution buffer in subsequent fractions of 15 µl each. Eluted fractions were mixed with 2X Laemmli buffer containing 10% β-mercaptoethanol and heated at 95°C for 10 min. Eluents were analyzed using SDS-PAGE followed by immunoblotting of the elutions with the protein specific antibodies (Anti-ChR1Ct and Anti-ChR2Ct). The same western blot was stripped with stripping buffer (60 mM Tris-Cl pH 6.8, 2% SDS and 50mM β-mercaptoethanol) and then probed again with the HRP conjugated primary GST antibody as a loading control.
Treatment of Chlamydomonas cells with the SUMOylation blocker, 2D08
The SUMOylation blocker, 2D08 (Cat. No. SML1052, Sigma Aldrich, Merck), has been used for several SUMO related studies (39-41). It is a cell permeable synthetic chemical reagent that blocks the SUMO tag transfer from E2 enzyme (UBC9) to the substrate. C. reinhardtii cell wall mutant strain, CC3403, was grown till O.D. reached ⁓0.6 under 14:10 hours light-dark cycle. Cells were then harvested by centrifugation at 3000 rpm and resuspended in lower volume (1/20) of fresh TAP media and 3 ml of resuspended cells was poured in two Petri dishes. Cells in one Petri dish were incubated for 8 hours with 100 µM of 2D08 (dissolved in DMSO), while another Petri dish containing equal number of cells was incubated with equal volume of DMSO as of 2D08, as negative control. For dish assay, the Petri dishes containing the 2D08 incubated cells and DMSO incubated as negative control were exposed to white light (Cool Fluorescent Lights) from one side of the Petri dishes. The movement of cell population was observed in both the Petri dishes and the images were captured accordingly. In order to detect the ChR1 in the 2D08 incubated cells, lysis of the cells were carried out using an 8:4:3 (v/v) solution of methanol:chloroform:water with the required volume of the cells to precipitate all the proteins (32). The precipitated proteins were then pelleted down and resuspended in 100 µl of 50 mM Tris-Cl buffer (pH 8.0), 150 mM NaCl supplemented with 20 mM NEM and PIC. Samples were then prepared from the resuspended and precipitated protein using 2X Laemmli buffer and heating at 65°C for 30 min. Samples were resolved on 8% SDS-PAGE and then immunoblotting was done with anti-ChR1Ct antibody followed by HRP-conjugated anti-rabbit secondary antibody.