Cell culture
Prostate cancer cells LNCaP and PC3 purchased from National Collection of Authenticated Cell Cultures (Shanghai, China) were maintained in F-12K medium (Thermo Fisher, CA, USA) supplemented with 10% fetal calf serum (FBS, Thermo Fisher). The lentiviral packaging cell line, 293T purchased from American Type Culture Collection (VA, USA) were maintained in Dulbecco’s modified Eagle’s DMEM medium (Dulbecco’s modified Eagle’s medium, DMEM, Thermo Fisher) supplemented with 10% FBS. All adherent cells were passaged by digestion with 0.25% trypsin (Thermo Fisher) once the cells reached a density of 70%, and were cultured in an atmosphere with saturated humidity at 37°C containing 5% CO2.
Tumor tissues
24 pairs of metastatic and non-metastatic prostate tumors with their precancerous lesions were collected from 24 prostate patients (12 cases of each group) in the Department of Jinshan Hospital of Fudan University. There was no age limit for enrollment. Informed consent was obtained from all patients in accordance with the standards set by the Ethics Committee of the Jinshan Hospital of Fudan University. Clinicopathological information pertaining to the patients and tumor classification is provided in Table 1. Total RNA extracted from the tissues was used for the detection of PBC11, hsa-miR-137 and Twist1 mRNA levels by using RT-qPCR (realtime quantitative PCR,RT-qPCR). Total protein was extracted from the tissues and used to detect the proteins of Twist1,E-cadherin and Vimentin by western blotting. The detection indexes were used for correlation analysis and evaluation of EMT of tumor cells.
Lentivirus mediated hsa-miR-137 overexpression and PBC11 silencing in prostate cancer cells
Human genomic DNA was extracted and used for amplification of the precursor of has-miR-137(270bp) with the primers 5′‐TGCTACCTTGGCAACCACGGGCG‐3′ and 5′‐GGGCGGGCTCAGCGAGCAGCAA‐3′. The PCR product was digested and ligated to expression vector to construct pCDH-miR-137. An siRNA (5’-GCTACTCTCACAGCAGCAC-3’) sequence complementary to PBC11 was chosen, and the corresponding shRNA oligonucleotide DNA synthesized were annealed and cloned to construct pSIH1-shRNA-PBC11. An siRNA with a scrambled sequence (5’- ACGACCCGCTTAGCCATAC -3’) was used as a NC (negative control, NC) to construct pSIH1-NC. The recombinant vectors were confirmed by DNA sequencing and endotoxin free DNA was prepared in all cases.
A total of 1 × 106 293T cells in logarithmic growth phase were plated in 10-cm dishes in 10 ml DMEM supplemented with 10% FBS and cultured overnight under normal conditions. Recombinant vectors (2μg each of pCDH-miR-137, pSIH1-shRNA-PBC11 or pSIH1-NC) and 10 μg of the pPACK packaging plasmids (System Biosciences, CA, USA) were co-transfected into 293T using Lipofectamine 2000 transfection reagent (Thermo Fisher). The culture medium was completely replaced with DMEM containing 1% FBS prior to transfection. After 48 h of transfection, the supernatant was harvested and cleared by centrifugation at 5,000 × g for 10 min at 4°C and then passed through a 0.45 µm polyvinylidene difluoride membrane (Millipore, MI, USA). The viral titer was determined using a gradient dilution method. The recombinant lentiviruses were named Lv-miR-137, Lv-shRNA-PBC11 and Lv-NC, respectively.
LNCaP and PC3 cells in logarithmic phase were plated in 6-well plates at a density of 2×105 cells/well. One day later, lentiviruses (Lv-NC, Lv-miR-137 and Lv-PBC11) were added to the cells at an MOI (multiplicity of infection, MOI) of 10. The infection efficiency was evaluated by observing the fluorescence of GFP (green fluorescent protein, GFP) 72 hour after infection. Total RNA were isolated and subjected to RT-qPCR to analyze the levels of hsa-miR-137 and PBC11.
Verification of the binding sites of hsa-miR137 in Twist1-3’ UTR (untranslated region, UTR)
We used Targetscan7.1(Whitehead Institute for Biomedical Research) to predict the potential hsa-miR-137 binding sites in the 3’-UTR of human Twist1 mRNA (NM_000474.4). Primers 5’ -TTGAGGACCCATGGTAAAATGC-3’ (forward) and 5’-TTTATATTTATTTATTGCAGAA-3’ (reverse) targeting the 3’-UTR of the Twist1 gene were designed and used to introduced the 109 bp PCR product containing the hsa-miR-137 target site (5’-GCAATAA-3’). The PCR product was digested and cloned into pGL3-promoter luciferase reporter vector (Promega Corporation, Madison, WI, USA) to generate the vector pGL3-wt (wild-type)-Twist1. The binding sites in the pGL3-wt-Twist1 was mutated from 5’- GCAATAA -3’ to 5’- AAAGATC -3’ to construct the mutated reporter vector pGL3-mt-Twist1. The hsa-miR-137 mimics (5’-GAUGCGCAUAAGAAUUCGUUAUUtt-3’), inhibitor (5’-AAUAACGAAUUCUUAUGCGCAUCtt-3’), and NC (5’-CGUUAAUGCAAUUAGGAUGCAUUtt-3’) were all chemically synthesized by Sangon Biotech (Shanghai, China). 293T cells were co-transfected with the hsa-miR-137 mimics, inhibitor, NC, and pGL-wt-Twist1 or pGL3-mt-Twist1 using Lipofectamine2000 according to the manufacturer’s instructions. The cells were harvested, and luciferase assays were performed using a Dual Luciferase Reporter Assay System (Promega) 48 hours after transfection. The effect of PBC11 depletion on the inhibition of luciferase activity by the hsa-miR-137 mimics was evaluated in 293T cells by co-transfection of hsa-miR-137 mimics, pGL3-wt-Twist1 and pcDH-PBC11.
Cell proliferative, invasion and migration assay
LNCaP and PC3 cells were used for cell viability assay by using a cell counting kit-8 assay kit (CCK-8, Dojindo, Japan). LNCaP cells were used for invasion assay by using the QCMTM 24-well Fluorimetric Cell Invasion Assay kit (Millipore) according to the manufacturer’s instructions. Migration ability of PC3 cells was assessed using wound healing assay. The cells used in the experiments were infected with the lentiviruses (Lv-NC or Lv-miR-137 or Lv-shRNA-PBC11 or Lv-miR-137+ Lv-shRNA-PBC11) for 72huors,then EMT model was established by adding TGF-β1(5ng/ml) for 48 hours.
RIP (RNA Binding Protein Immunoprecipitation, RIP)
We identified the binding of Twist1 to PBC11 in LNCaP cells by RIP experiment. Twist1 protein in cells was precipitated by IP and its bound RNA was obtained from eluent. Then, the target product (PBC11) in the purified product was qualitatively detected by RT-PCR. The specific scheme of RIP refers to Ahmad m Khalil's research [8]. The 2μg Twist1 primary antibody (Abcam, Cambridge, UK) was used for IP, and the PCR primer sequence used for target product identification is 5’-AACCACGTGCCCCACAGCGG-3’ (forward) and 5’-CTCTGGTGGATGCTGGTTATT-3’(reverse).
RT-qPCR
Total RNA was isolated and reverse-transcribed into cDNA using M-MLV reverse transcriptase. RT-qPCR was performed using the SYBR Premix Ex Taq™ kit and TP800 System (Takara,Dalian,China). The PCRs were carried out under the following conditions: 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 20 s, and extension at 72°C for 20 s, using cDNA (200 ng) as the template. The levels of Twist1 were normalized to the expression of the endogenous housekeeping gene, β-actin, using the 2 -ΔCt method. The PCR primers used were: Twist1, 5’-TCATGGCCAACGTGCGGGAG-3’ (forward) and 5’-TTGTCCGAGGGCAGCGTGGGGATGA-3’ (reverse) and β-actin, 5’-CCTGTACGCCAACACAGTGC-3’ (forward) and 5’-ATACTCCTGCTTGCTGATCC-3’ (reverse). To normalize the level of hsa-miR-137, the level of U6 snRNA was used as reference. The specific primers used for reverse transcription were random9 for the U6 snRNA and 5’-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGAAATAAC-3’ for hsa-miR-137. The PCR primers were as follows: U6 snRNA, 5’-GTGCTCGCTTCGGCAGCACAT-3’ (forward) and 5’-TACCTTGCGAAGTGCTTAAAC-3’ (reverse); hsa-miR-137, 5’-GCCGGCGCCCGAGCTCTGGCTC-3’ (forward) and 5’- GATGCGCATAAGAATTCGTTATT-3’ (reverse).
Western blotting
Total protein was extracted from cells using the M-PER mammalian protein extraction reagent or from tissues using the T-PER tissue protein extraction reagent (Thermo Fisher). Equal amounts of total proteins (12 μg) were separated by SDS-PAGE (sodium dodecylsulfate polyacrylamide gel electrophoresis, SDS-PAGE, 11% gel) and transferred onto nitrocellulose membranes (Millipore). The blots were probed with primary antibodies against human Twist1 (1:500), E-cadherin (1:500), Vimentin (1:600), N-cadherin (1:500), AKT1 (1:400) and β-actin (1:1000) (Abcam), followed by probing with the corresponding secondary HRP-conjugated anti-rabbit antibody (Abcam). After washing the membranes, the bands were detected by chemiluminescence and imaged with X-ray films. β-actin was used as an endogenous reference for normalization.
Statistical analysis
The data are shown as the means ± standard deviation (SD) of three independent experiments. All statistical data were analyzed using SPSS GradPack version 20.0 statistical software (IBM Corp., Armonk, NY, USA) and GraphPad Prism 7.0 (GraphPad Software, Inc., La Jolla, CA, USA). Comparisons between groups were performed using a two-tailed Student's t-test or one-way ANOVA with a post-hoc Tukey test. Differences were considered statistically significant when p < 0.05.
Data availability
The data that support the findings of this study are available from the corresponding author upon reasonable request.