2.1 Materials
Alpinetin (> 98% purity; Fig. 1A) was purchased from Tongtian Biotechnology Co. (Shanghai, China) and dissolved in dimethyl sulfoxide (DMSO). Modified minimal essential medium (α-MEM) and fetal bovine serum (FBS) were obtained from Thermo Fisher Scientific (Scoresby, Vic, Australia). Recombinant mouse RANKL and M-CSF proteins were purchased from Novoprotein Scientific Inc. (Shanghai, China). Rabbit primary antibodies against JNK, ERK, p38, P-JNK, P-ERK, p-p38, AKT, P-AKT, IKβα, p-IKβα, p65, p-p65, ATG7, and LC3 were purchased from Cell Signaling Technology (Danvers, MA, USA). Rabbit polyclonal antibodies against NFATc1, c-Fos, c-Src, cathepsin K (CTSK), and lysosomal-associated membrane protein 1 (LAMP1) were purchased from Abcam (Cambridge, MA, USA), and primary antibodies against integrin β3, PKC-β, and TFEB were obtained from Proteintech (Wuhan, Hubei, China). Reagents for tartrate-resistant acid phosphatase (TRAP) staining, western blotting, and quantitative real-time PCR (qRT-PCR) were purchased from Sigma-Aldrich (St. Louis, MO, USA).
2.2 Cell isolation and cell viability assay
Long bones were obtained from 8-week-old C57BL/6 mice, and bone macrophage precursors were isolated by rinsing the bone medullary cavity. Bone marrow macrophages (BMMs) were obtained by treating macrophage precursors with 40 ng/mL M-CSF for at least 3 days. Subsequently, adherent cells were used for the cell viability assay and osteoclast differentiation.
BMMs and MC3T3-E1 cells were seeded in 96-well plates and treated with increasing concentrations of alpinetin (0–50 µM) for 4 days. Subsequently, CCK-8 solution (10 µL/well) was added, and cells were incubated for an additional 4 h to assess cell viability. The optical density was measured at 450 mm using the ELX808 absorbance microplate reader (BioTek, Winooski, VT, USA).
2.3 Osteoclast differentiation and TRAP staining
To determine the inhibitory effect of alpinetin on osteoclast differentiation, BMMs were seeded in 48-well plates (2 × 104 cells/well) and treated with 40 ng/mL M-CSF and 75 ng/mL RANKL for 4 days. Additionally, cells were exposed to different concentrations of alpinetin (0, 5, 10, and 20 µM). After incubation, cells were carefully washed three times with phosphate-buffered saline (PBS) and fixed in 4% paraformaldehyde for at least 30 min. The number and size of mature osteoclasts were determined using ImageJ (National Institutes of Health, Bethesda, MD, USA); only cells containing at least three nuclei were considered differentiated osteoclasts.
2.4 F-actin ring and immunofluorescence staining
BMMs were incubated with RANKL and different concentrations of alpinetin. After treatment, cells were fixed in 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 in PBS for 30 min. After a 1 h incubation with rhodamine-phalloidin, cells were carefully washed three times and stained with DAPI for 5 min. Stained cells were observed under a confocal microscope.
BMMs treated with different concentrations of alpinetin in osteoclastogenic medium were also used for immunofluorescence staining. Fixed and permeabilized cells were blocked with 2% bovine serum albumin for 20 min and incubated with fluorescently labeled primary antibodies overnight. Subsequently, cells were incubated with secondary antibodies for 1 h at 37℃ and stained with DAPI for 5 min. Cells were observed under a confocal microscope, and fluorescent signals were analyzed using ImageJ.
2.5 Bone resorption assay
BMMs were seeded onto bone discs (2 × 104 cells/well) and grown in complete α-MEM containing 40 ng/mL M-CSF overnight. Subsequently, cells were stimulated with 75 ng/mL RANKL and increasing concentrations of alpinetin (0, 5, 10, and 20 µM) for 7–8 days. Adherent cells were thoroughly removed from the bone discs, and the resorption pits were imaged using a Hitachi S-3700N scanning electron microscope (Chiyoda, Tokyo, Japan). Three random fields were used to determine the bone absorption area.
2.6 qRT-PCR
To assess the effects of alpinetin on osteoclast-associated gene expression, BMMs were seeded in 12-well plates and cultured with or without different concentrations of alpinetin. Total RNA was isolated using TRIzol reagent (Takara, Dalian, China) and reverse-transcribed into cDNA, which was used for qRT-PCR. The expression levels of target genes were normalized to those of Gapdh. qRT-PCR assays were repeated at least three times. The murine primer sequences of osteoclast-specific markers were presented in Table 1.
Table 1
Primer sequences for RT-PCR
Gene | Forward (5′-3′) | Reverse (3′-5′) |
GAPDH TRAP V-ATPase-a3 NFATc1 Cathepsin K DC-STAMP MMP-9 TFEB Clcn7 Tcirg1 PKCβ Acp5 Atp6v0d2 Integrin-β3 c-Src | ACCACAGTCCATGCCATCAC CACTCCCACCCTGAGATTTGT GCCTCAGGGGAAGGCCAGATCG CCGTTGCTTCCAGAAAATAACA CTTCCAATACGTGCAGCAGA AAAACCCTTGGGCTGTTCTT CAAAGACCTGAAAACCTCCAA CCACCCCAGCCATCAACAC GACTGGCTGTGGGAAAGGAA GAGACCTCAACGAATCCGTGA TCCCTGATCCCAAAAGTGAG ACACAGTGATGCTGTGTGGCAACTC AAGAGCTGCGTGGAGACAAA TGACATCGAGCAGGTGAAAG CCAGGCTGAGGAGTGGTACT | TCCACCACCCTGTTGCTGTA CCCCAGAGACATGATGAAGTCA GGCCACCTCTTCACTCCGGAA TGTGGGATGTGAACTCGGAA TCTTCAGGGCTTTCTCGTTC AATCATGGACGACTCCTTGG GGTACAAGTATGCCTCTGCCA CAGACAGATACTCCCGAACCTT TCTCGCTTGAGTGATGTTGACC CATTTCAGGGGTGTGCCTTCA AACTTGAACCAGCCATCCAC CCAGAGGCTTCCACATATATGATGG CCACCTTCTTCAGCCTTCGT GAGTAGCAAGGCCAATGAGC CAGCTTGCGGATCTTGTAGT |
2.7 Western blotting
Cell lysates were obtained by high-speed centrifugation (14,000 rpm) for 15 min, and proteins were collected from the supernatants. Equal amounts of proteins were resolved by SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes for 2 h. After blocking with 10% milk, PVDF membranes were incubated with primary antibodies overnight at 4℃ followed by secondary antibodies for 2 h at 4℃. Protein signals were detected using the Bio-Rad XRS chemiluminescence detection system (Hercules, CA, USA) and analyzed using ImageJ.
2.8 Establishment of an osteoporosis mouse model and bone histological analysis
To confirm the inhibitory effects of alpinetin on estrogen deficiency-induced bone mass loss and osteoclast activity, we established an osteoporosis mouse model. Twenty 8-week-old female C57BL/6 mice were randomly divided into four different groups: sham-surgery, OVX, low dose (LD), and high dose (HD) groups. One week after surgery, mice in the LD and HD groups were intraperitoneally injected with 5 mg/kg or 25 mg/kg alpinetin, respectively, every 2 days. Mice in the sham-surgery and OVX groups received an equal volume of PBS. After 4 weeks of treatment, mice were euthanized by anesthetic overdose. Bilateral femurs were isolated, fixed in 4% paraformaldehyde solution for 3 days, and evaluated by microcomputed tomography (micro-CT). Subsequently, bones were decalcified with 10% EDTA for half a month and cut into 4-µm sections, which were subjected to histological analysis.
2.9 Alkaline phosphatase (ALP) and alizarin red staining (ARS)
To determine the effects of alpinetin on osteogenesis in vitro, we seeded MC3T3-E1 cells in 12-well plates, and after overnight incubation with complete α-MEM, cells were treated with alpinetin (0, 20, and 50 µM) in osteogenic medium for 3 or 14 days. Cells treated for 3 days were subjected to ALP staining, and those treated for 14 days were used for ARS.
2.10 Measurement of reactive oxygen species (ROS)
To assess the effects of alpinetin on cellular ROS, we seeded RAW 264.7 cells in 12-well plates (5 × 104 cells/well) and pretreated them with alpinetin for 12 h. Subsequently, alpinetin-pretreated cells were incubated with 10 mM 2′,7′-dichlorodihydro-fluorescein diacetate (H2DCFDA) for 30 min in the dark, and then stimulated with 75 ng/mL RANKL for another 30 min. Cellular ROS levels were measured on a multimodal microplate reader (SpectraMaxM5; Molecular Devices, Sunnyvale, CA, USA).
2.11 Statistical analysis
All results are presented as means ± standard deviation (SD). Statistical significance was determined by Student’s t-test or one-way ANOVA. P-values < 0.05 were considered statistically significant.