Synthesis of PCFMN
The PCFMN was synthesized through a simple chemical process. To obtain cartilage-targeting products PEG-CollBP, 50 mg NHS-PEG-COOH (Mw, 3400 Da, Ruixi Bio, Xi’an, China) and 40 mg CollBP (WYRGRL, GL Biochem, Shanghai, China) were dissolved in 1 mL N,N-dimethylformamide (DMF) (Energy Chemical,Shanghai༌China) followed by the addition of 20 µL DIPEA (Aladdin, Shanghai, China). The mixture was stirred overnight. After reaction, the solution was purified by dialysis (Mw = 1500 Da) with deionized water to remove excess CollBP and DMF, and lyophilized for further use. Then, the carboxyl of PEG-CollBP was activated by N-(3-dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC)/dimethylaminopyridine (DMAP), and reacted with the hydroxy of FMN to synthesize PCFMN by esterification reaction. Firstly, EDC and DMAP were mixed with PEG-CollBP in DMF (molar ratio of PEG-CollBP: EDC: DMAP is 1:1.1:0.1). Half an hour later, the FMN solution was slowly added to the above mixture, followed by stirring at room temperature for 48 h. Next, the products were dialyzed (Mw = 1500 Da) for 48 h and lyophilized (Figure. 2a). Finally, to obtain fluorescent nanoparticles, 2 mg fluorescent probe DID (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt) and 5 mg PCFMN or PFMN (without cartilage-targeting peptide) were dissolved in dimethyl sulfoxide (DMSO) and stirred overnight. The whole procedure was performed in dark. And the final products were obtained after dialysis 48 h and lyophilization.
Characterization Of Pcfmn
The morphology of PCFMN was determined by using transmission electron microscopy (TEM) (Hitachi, Japan). The size distribution of PCFMN in aqueous suspension was measured by using Malvern Zetasizer Nano ZS90, and all measurements were carried out at 25 °C. The PCFMN was confirmed by ultra-violet and visible spectrophotometer (UV-Vis, TV-1901, Beijing), FTIR spectrum (PerkinElmer, Spectrum100, USA) and 1H NMR (AVANCE III HD600, Zurich, Switzerland). Specifically, to study the solubilization and stability of PCFMN, 5 mg FMN and 5 mg PCFMN were dissolved in 1 mL of ultrapure water, respectively, followed by ultrasound for 15 minutes and station for 3 day, and then photographed for observation.
Culture Of Chondrocytes
Primary chondrocytes were harvested from 5-day-old Sprague Dawley rat. Curtly, cartilage was obtained from the joints of rats’ limbs and cut into small pieces of nearly 1 mm size. The cartilage debris were digested by 0.25% trypsin at 37 oC for 30 minutes, and 0.2% type II collagenase (Solarbio, Beijing, China) for 4 h. Cells were collected by centrifugation (1000 rpm, 5 min) and cultured in Modified Eagle’s medium (Solarbio, Beijing, China) containing 10% (v/v) fetal bovine serum (Sijiqing, Zhejiang, China) and 1% (v/v) penicillin/streptomycin (Solarbio, Beijing, China) in an incubator with 5% CO2 at 37 °C. Cells were passaged when reaching nearly 80%-90% till second-generation for further research.
Cytotoxicity Studies
The cytotoxicity of PCFMN was measured by MTT assay. Briefly, the chondrocytes were seeded in 96-well plate at a density of 6,000 cells per well. After cells adherence, 200 µL of FMN or PCFMN containing formononetin of different concentrations incubated for 24 h. Then, 15 µL of MTT was added to each well. After another 4 hours incubation, all the medium was removed and then DMSO (150 µL) were added to each well. Finally, the optical density at 490 nm was measured by a microplate reader (Thermo Scientific Multiskan GO Microplate Spectrophotometer). Also, MTT assay was used to detect the effects of FMN and PCFMN on the proliferation of chondrocytes induced by IL-1β. The chondrocytes were cultured in a 24-well plate with 1.5 × 104 cells per well for 24 h, then stimulated with IL-1β (10 ng/mL) to constructed osteoarthritis model in vitro. Finally, treated with the FMN (1.25 µg/mL) or PCFMN (1.25 µg/mL) for another 24 h. Next steps were similar with MTT method.
In vitro cellular uptake
As the nanoparticles carry red fluorescence dye for cell membrane, cellular uptake of PCFMN and FMN can be detected by fluorescence inversion microscope (Olympus, Japan). Chondrocytes were cultured in 24-well plates (1 × 104 cells/well). When cells were fully attached, fresh medium containing PFMN-DID (without cartilage-targeting peptide) (10 µL, 1 mg/mL) and PCFMN-DID (10 µL, 1 mg/mL) fluorescent nanoparticles were added as a substitute for the old medium. After 24 hours incubation, cold PBS and 4% paraformaldehyde were respectively used to wash cells and then fix for 20 minutes. Following, chondrocytes nuclear were stained by DAPI for 15 minutes. Finally, the plate was analyzed by a fluorescence inversion microscope (Olympus, Japan) to obtain corresponding fluorescence images.
In vitro anti-inflammatory activity
To examined the effect of FMN and PCFMN on the proliferation of normal chondrocytes or IL-1β-induced chondrocytes, the chondrocytes were plated in 6-well and 24-well plates of 8 × 104 cells or 1.5 × 104 cells per well. After stimulation with IL-1β of 10 ng/mL for 2 h, the FMN (1.25 µg/mL) or PCFMN (1.25 µg/mL) were added to incubate with cells for 24 h, while cells in the normal group were untreated. Then, cells were then fixed and stained by hematoxylin and eosin staining (Solarbio, Beijing,China). Immunofluorescence (IF) staining of OA-specific markers, MMP-13, was used to detect the anti-inflammatory ability of FMN and PCFMN. In immunofluorescence (IF) test, samples were incubated with primary antibody against MMP-13 (Boster, Wuhan, China, 1:200) overnight at 4 oC. The second antibody FITC-anti-rabbit IgG (Boster, Wuhan, China) was then added for incubating with samples one more hour at room temperature in dark. Finally, the samples were treated with DAPI for nuclei stained. Images was captured using a fluorescence inversion microscope (Olympus, Japan).
Qrt-pcr Detection
Chondrocytes were seeded in 6-well plates to obtain total RNA. After treated with FMN (1.25 µg/mL) or PCFMN (1.25 µg/mL) treatments for 24 h, the mRNA expression level of cartilage-specific maker (e.g., Col2a1) and some gene expressions of catabolic markers of OA (e.g., IL-1β, MMP-13 and MMP-3) were analyzed by the real-time quantitative polymerase chain reaction (qRT-PCR). An RNA isolation kit (Megentec, Guangzhou, China) was used to harvest the RNA according to its manufacturer’s protocol. The reverse transcription was conducted by using a reverse transcription kit (Fermentas Company, USA). All qRT-PCR reactions were performed by a light Cycle 96 system (Roche, Switzerland) under the conditions of 10 min at 95 oC, followed by 40 cycles of 10 s at 95 oC and then 60 s at 60 oC. The 2−ΔΔCt method was used to calculate the relative gene expression levels. The primers of RT-qPCR are summarized in Table 1.
Table 1
Primers for RT-PCR performance.
gene | Forward primer (5'-3') | Reverse primer (5'-3') | size |
MMP-13 | GGACAAAGACTATCCCCGCC | GGCATGACTCTCACAATGCG | 20 |
MMP-3 | GTTCTGGGCTATACGAGGGC | TTCTTCACGGTTGCAGGGAG | 20 |
IL-1β | GCACAGTTCCCCAACTGGTA | GGAGACTGCCCATTCTCGAC | 20 |
Col2a1 | GACTGTGCCTCGGAAGAACT | TCTGGACGTTAGCGGTGTTG | 20 |
GAPDH | TCCAGTATGACTCTACCCACG | TCTGGACGTTAGCGGTGTTG | 20 |
Induction Of Osteoarthritis In Rat
With ethical approval of the Institutional Ethics Committee of Guangxi Medical University (October 25, 2018), a total of thirty Sprague Dawley rats (male, 180–200 g) were experimented in vivo. We used an anterior cruciate ligament transection (ACLT) method to establish OA model, and all rats were randomly divided into three groups (Saline, FMN and PCFMN groups). 4 weeks after surgery, each knee joints of the three groups was respectively injected 0.5 mL of saline, FMN (1.25 µg/mL) or PCFMN (1.25 µg/mL) once per week for 4 or 8 weeks under the same conditions. A normal group underwent sham operation, that the rats were conducted the same surgery except for cutting the anterior cruciate ligament, meanwhile, with no further injection.
In vivo optical imaging
To analyze the nanodrug retention time in vivo, we used an in-vivo Multispectral Imaging System (Bruker, Germany) to detect the fluorescence signals of PCFMN and PFMN labeled with DID in knee OA model. After IA-injection, the fluorescence imaging was conducted (n = 3). Images were obtained at corresponding time points (0, 1, 3,7, 19 d).
Anti-inflammatory effect in vivo
After the treatment for 4 and 8 weeks, all rats were euthanized with excessive anesthesia and their knee joint samples were obtained. The repaired articular cartilages were harvested. Blinded to the treatment groups, three independent observers (SC, PYF, XF) conducted the macroscopic evaluation and a nine-area grid of each medial and lateral tibia plateau was used to evaluate the grade of articular cartilage surface (scale of 0–8)[30]. Moreover, the repaired knee joints obtained from the rats were collected and fixed with 4% formaldehyde. Then, after decalcified for one month, the joints were embedded in paraffin and sliced into thickness of 5 µm. With sections dewaxed, histological analysis (H&E, Safanin O and immunohistochemistry staining for MMP-13) was conducted. Then, images were captured on optical microscope. The OARSI cartilage OA histopathology grading system was adopted to grade the repaired tissues[31].
Statistical analysis
All the data were reported as the means ± standard deviations from at least three repeated experiments. Comparison between OA and treatment groups was examined by one-way analysis of variance (ANOVA). P < 0.05 was considered statistically significant.