Reagents
Monoclonal Anti-actin antibody, anti-fatty acid synthase (FAS), Prussian Blue, sodium pantothenate and trypsin were purchased from Sigma Chemical Co. (St. Louis, MO). Anti-mitochondrial acyl carrier protein (mtACP), anti-aminoadipate semialdehyde dehydrogenase phosphopantetheinyl transferase (AASDHPPT), anti-NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9 (NDUFA9), anti-NADH-ubiquinone oxidoreductase chain 1 (MTND1), DAPI and Hoechst 3342, were purchased from Invitrogen/Molecular Probes (Eugene, OR). NFS1 antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-PANK2, complex 1 activity kit, PDH activity kit and aconitase activity kit were purchased from Abcam (Cambridge, UK). Anti-mitochondrial 10-formyltetrahydrofolate dehydrogenase (ALDH1L2), anti- cytosolic 10-formyltetrahydrofolate dehydrogenase (ALDH1L1), anti-alpha-aminoadipic semialdehyde synthase, mitochondrial (AASS), anti-LYRM4, anti-Tau clone HT7, anti-ISD11, anti-PANK1 and anti-PANK3 were purchased from Thermo-Fisher (Waltham, MA). Anti-lipoic acid was acquired from Merck (Darmstadt, Germany). A cocktail of protease inhibitors (complete cocktail) was purchased from Boehringer Mannheim (Indianapolis, IN). The Immun Star HRP substrate kit was from Bio-Rad Laboratories Inc. (Hercules, CA).
Ethical Statements
Approval of the ethical committee of the Hospital Universitario Virgen Macarena y Virgen de Rocío de Sevilla (Spain) was obtained, according to the principles of the Declaration of Helsinki and all the International Conferences on Harmonization and Good Clinical Practice Guidelines.
Cell culture
We used primary skin fibroblasts from three unaffected subjects (control 1, 2 and 3, two adults and one neonatal) purchased from ATCC and three patients from the Movement Disorder Unit of Hospital Universitario Virgen del Rocío, Sevilla, Spain, and from the Movement Disorders Bio-Bank available at the Neurogenetics Unit of the Neurological Institute ‘Carlo Besta’ (INCB), Milan, Italy. One patient (P1) is compound heterozygous carrier of changes c.[747dup] that causes a frameshift (p.Arg249Profs) mutation triggering a premature stop codon and c.[1475C>T] (p.Ala492Gly) that causes a missense mutation which is predicted to be damaging by prediction tools such as PolyPhen2 (44). The second patient (P2) is compound heterozygous carrier of changes in position c.[240_241del] c.[650C>T] (p.Asp217Gly) which have been previously described (45). The third patient (P3) P3 carries a homozygous mutation c.[1259delG] causing a frameshift p.[Gly420Valfs*30] mutation(46). The reference sequence used for the PANK2 mutations was NM_153638. Control values represent means±SD for three control fibroblast cell lines. Fibroblasts were grown in DMEM (Sigma) supplemented with 10% FBS (Sigma), 100 mg/ml streptomycin, 100 U/ml penicillin and 4 mM l-glutamine (Sigma). All the experiments were performed with fibroblasts cell cultures with a passage number <10.
Immunoblotting
Western blotting was performed using standard Methods described in previous manuscripts of the research group (8). After protein transfer, membranes were incubated with various primary antibodies diluted 1:1000, and then with the corresponding secondary antibody coupled to horseradish peroxidase at a 1:10000 dilution. Specific protein complexes were identified using the Immun Star HRP substrate kit (Biorad Laboratories Inc., Hercules, CA, USA).
Protein loading was assessed by Ponceau staining and actin expression levels. If the molecular weight of proteins did not interfere, membranes were re-probed with different antibodies. In the case of proteins with different molecular weights, membranes were cut and incubated with specific antibodies.
Immunofluorescence microscopy
For immunofluorescence studies, we followed a protocol previously described by our research group (47). Cells were grown on 1mm width (Goldseal No. 1) glass coverslips for 24–48 h in DMEM containing 20% FBS. Cells were rinsed once with PBS, fixed in 3.8% paraformaldehyde for 5 min at room temperature, and permeabilized in 0.1% saponin for 5 min. For immunostaining, glass coverslips were incubated with primary antibodies diluted 1:100 in PBS, 1–2 h at 37◦C in a humidified chamber. Unbound antibodies were removed by washing the coverslips with PBS (three times, 5 min). The secondary antibody, a FITC-labelled goat anti-mouse antibody or a tetramethyl rhodamine goat anti-rabbit (Molecular Probes), diluted 1:100 in PBS, were added and incubated for 1 h 37ºC. Coverslips were then rinsed with PBS for 3 min, incubated for 1 min with PBS containing Hoechst 33342 (1 µg/ml) and washed with PBS (three 5 min washes). Finally, the coverslips were mounted onto microscope slides using Vectashield Mounting Medium (Vector Laboratories, Burlingame, CA, USA) and analyzed using an upright fluorescence microscope (Leica DMRE, Leica Microsystems GmbH, Wetzlar, Germany). Colocalization studies were performed using a DeltaVision system (Applied Precision; Issaquah, WA) with an Olympus IX-71 microscope (Olympus Corporation, Shinjuku, Tokyo, Japan).
Real-time quantitative PCR
Expression of PANK2 gene in fibroblasts was analysed by real time quantitative PCR using mRNA extracts. mRNA was extracted by using standard methods and SYBR Green protocol as a method designed to detect accurate quantification of gene expression and RT-PCR reactions. PANK2 primers used 5’ TTCCCACTCATGACA
TGCCT-3’ (Forward primer) and 5’-GTGACCGTCCATTGAATCCG-3’ (Reverse primer) amplifying a sequence of 215 nucleotides. Actin was used as a housekeeping control gene and the primers were 5’- AGAGCTACGAGCTGCCTGAC -3’ (Forward primer) and 3’- AGCACTGTGTTGGCGTACAG -5’ (reverse primer).
Complex I activity
Complex I activity in whole cells was measured using the Complex I Enzyme Activity Dipstick Assay Kit (ab109720, ABCAM, Cambridge, MA, USA) according to manufacturer’s instructions. Three biological replicates were used per measurement. Results are expressed as enzyme activity respect to control. The signal intensity was analyzed by a Molecular Imager ChemiDoc XRS+ System (Bio-Rad Laboratories Inc., USA).
PDH activity
PDH complex activity in whole cells was measured using the Pyruvate dehydrogenase (PDH) Enzyme Activity Dipstick Assay Kit (ab109882, ABCAM, Cambridge, MA, USA) according to manufacturer’s instructions. Three biological replicates were used per measurement. Results are expressed as enzyme activity respect to control. The signal intensity was analyzed by a Molecular Imager ChemiDoc XRS+ System (Bio-Rad Laboratories Inc., USA).
Cell fractionation
Cells were harvested and homogenized using a fractionation buffer containing 250 mM sucrose, 10 mM Tris, 1 mM EDTA and proteases inhibitors cocktail, pH 7.4. Cell suspension was passed through a 25-gauge needle 10 times using a 1 mL syringe. Next, nuclei and intact cells were removed by centrifugation at 1500g for 20 min. The supernatant containing intact mitochondria was transferred into a new tube and centrifuged at 12000g for 10 min (“mitochondria fraction”. Supernatant (“cytosolic fraction”) was transferred into another new tube. Cytosolic fractions were concentrated using Centricon YM-10 devices (Millipore) according to the manufacturer’s instructions.
Aconitase activity mitochondria and cytosolic
Cytosolic and mitochondria fraction were used for aconitase activity using the Aconitase Activity Assay Kit (ab83459, ABCAM, Cambridge, MA, USA) according to manufacturer’s instructions. Three biological replicates were used per measurement. Results are expressed as enzyme activity respect to control. Absorbance at 450nm was measured using a POLARstar Omega Microplate Reader.
Generation of induced neurons from fibroblasts by direct reprogramming
Neurons were generated from patient and control fibroblasts by direct reprogramming as previously described by Drouin-Ouellet et al. (15, 48). Controls and patients-derived fibroblasts were plated onto 0.1% gelatin-coated 24-well plates or µ-Slide 4 Well Ibidi plates (2.8e4 cells/cm2). The day after, dermal fibroblasts were transduced with one-single lentiviral vector containing neural lineage-specific transcription factors (Acsl1 and Brn2) and two shRNA against the RE1-silencing transcription factor (REST) complex, generated as previously described (49). The plasmid was a gift from Dr. Malin Parmar (Developmental and Regenerative Neurobiology, Lund University, Sweden). Transduction was performed at a multiplicity of infection (MOI) of 30. The day after, the cells were switched into fresh fibroblast medium and after a further 48 h, the medium was replaced with neural differentiation medium (NDiff227; Takara-Clontech) supplemented with neural growth factors and small molecules at the concentrations previously described (15): LM-22A4 (2 mM, R&D Systems), GDNF (2 ng/ml, R&D Systems), NT3 (10 ng/ml, R&D Systems), db-cAMP (0.5 mM, Sigma), CHIR99021 (2 mM, Sigma), SB-431542 (10 mM, R&D Systems), noggin (50 ng/ml, R&D Systems), LDN-193189 (0.5 M, Sigma), valproic acid sodium salt (VPA; 1 mM, Sigma). The medium was changed every 2–3 days for a further 10 days. The medium was replaced with neuronal medium supplemented with only growth factors until the end of the conversion. Neuronal cells were identified by the expression of Tau or MAP2. DAPI+ and Tau+/MAP2+ cells were considered induced neurons. Conversion efficiency was calculated as the number of Tau+ cells over the total number of fibroblasts seeded for conversion. Neuronal purity was calculated as the number of Tau+ cells over the total cells in the plate after reprogramming.
For neuronal enrichment for Western blot analysis, eighteen days post-infection, neurons were detached and seeded in 24 well culture plates coated using polyornithine (15μg/ml), fibronectin (0.5ng/μl) and laminin (5 μg/ml) to increase the purity of the iNs culture up to 95% without the need of further purification steps.
Statistical analyses
Statical analysis was routinely performed as formerly described by our research group (50). We used non-parametric statistics that do not have any distributional assumption in cases when number of events was small (n<30) (51). In these cases, multiple groups were compared using a Kruskal-Wallis test. In case of only two groups, they were compared using a Mann-Whitney test. In cases when number of events was higher (n>30), we applied parametric tests. In these cases, multiple groups were compared using a one-way ANOVA. Bonferroni post-hoc testing was employed after ANOVA for testing for significant differences between groups. In case of only two groups, they were compared using a Student’s t-test with a Welch’s correction. Statistical analyses were conducted using the GraphPad Prism 7.0 (GraphPad Software, San Diego, CA). The data are reported as the mean±SD values or as representative of at least three independent experiments. P-values of less than 0.05 were considered significant.