Development of Species/Genus specific Primers for Identification of Three Trichoderma Species and for Detection of Trichoderma Genus

doi:10.21203/rs.3.rs-139038/v1

Download PDF

Original article

Development of Species/Genus specific Primers for Identification of Three Trichoderma Species and for Detection of Trichoderma Genus

https://doi.org/10.21203/rs.3.rs-139038/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Trichoderma is a widely used bio-control agent, and has excellent ability to antagonize plant pathogens and promoting plant growth. It has been successfully used to control various plant diseases. The premise of using Trichoderma is accurate identification of it. In this study, four sets of species/genus-specific primers were designed based on the translation elongation factor 1-alpha (tef1) gene and internal transcribed spacer (ITS) region, in order to identify Trichoderma harzianum, T. koningiopsis, and T.virens, and detect the genus of Trichoderma. Here, the rapid, simple, and reliable PCR methods were development using the species-specific primers EHarF2/EHarR2, EKoisF/EKoisR, and EVireF/EVireR to produce 253 bp (tef1 gene), 255 bp (tef1 gene), and 263 bp (tef1 gene) DNA bands to identify T. harzianum, T. koningiopsis, and T. virens, respectively. The genus-specific primers ITricF/ITricR produces a single DNA band in the range of 103–113 bp (ITS region) to distinguish Trichoderma from other genera fungi, and the size of the band is related to the species of Trichoderma. In addition, ITricF/ITricR could use for real-time PCR amplification for detection the quantity of Trichoderma spp..

Applied & Industrial Microbiology

Trichoderma harzianum

Trichoderma koningiopsis

Trichoderma virens

Trichoderma spp.

specific primers

Trichoderma is a widely used microorganism, which can be used not only for the production of industrial enzymes, but also for controlling plant diseases and promoting plant growth (Vinale et al. 2008; Nawrocka and Małolepsza 2013; Lehmann et al. 2016). At present, many pesticides and fertilizer products made of Trichoderma have been applied (Woo et al. 2014). Among Trichoderma species, T. harzianum, T. virens, T. koningiopsis have been widely exploited for prevention and control a variety of plant diseases (Moreno et al. 2009; Daguerre et al. 2014; Contreras-Cornejo et al. 2016).

Correct identification of Trichoderma species is a prerequisite for the use of Trichoderma. It is difficult to identify Trichoderma species by morphological characteristics (Błaszczyk et al. 2011; Sun et al. 2016; Kredics et al. 2018). The current method of identifying Trichoderma is mainly a combination of morphological and molecular characteristics (Jaklitsch 2009; Zhu and Zhuang 2015). The genes currently used for molecular identification of Trichoderma mainly include internal transcribed spacer (ITS), translation elongation factor 1-alpha (tef1) gene, RNA polymerase II subunit (rpb2) gene, and ATP citrate lyase (acl1) gene (Jaklitsch and Voglmayr 2015; Du Plessis et al. 2018). In a laboratory without a sequencing instrument, this is a time-consuming procedure for obtaining PCR products sequence information. In addition, identification of Trichoderma species based on BLAST searches may cause misidentification (Meincke et al. 2010). For the rapid identification of Trichoderma species, the ITS region, tef1 gene, and rpb2 gene are using to be the barcode locus for designing specific primers. So far, several species-specific primers have been developed for Trichoderma species identification (Friedl and Druzhinina 2012; Prabhakaran et al. 2015; Saroj et al. 2015).

Trichoderma are applied to the soil for controlling a variety of soil-borne plant diseases, such as tomato fusarium wilt and groundnut collar rot disease (Gajera et al. 2015; Taghdi et al. 2015). The amount (density) of Trichoderma in soil was related to the efficiency of inhibiting to soil-borne disease, high densities of Trichoderma spp. can effectively suppress pathogens in soil (Kataoka et al. 2010; Huang et al. 2011; Oskiera et al. 2017). However, the viability of Trichoderma in soil is affected by various factors such as soil water content, nutrients, and pH (Daryaei et al. 2016a; Daryaei et al. 2016b). So, monitoring the quantity of Trichoderma in soil can provide a scientific basis for increasing or no application of Trichoderma to soil. And, it is also important to determine Trichoderma where it extends in the soil. So, Hagn et al. (2007) developed genus-specific primers to identify and quantify Trichoderma spp. in soils.

At presently, a number of species/genus-specific primers have published for using to identify T. harzianum, T. virens and Trichoderma genus (Kredics et al. 2018). However, after our tests, it was found that not all published specific primers can accurately identify the target species of Trichoderma, and some genus specific primers of Trichoderma produce non-specific amplification products, so these primers can't be used to detect the amount of Trichoderma in environmental samples.

Therefore, in order to obtain more alternative specific primers for identification of T. harzianum, T. virens, T. koningiopsis, and for detection the quantity of Trichoderma genus. The aims of the study were to: 1) establish easy and reproducible PCR methods with species-specific primers base on tef1 gene for rapid identification T. harzianum, T. virens, and T. koningiopsis; 2) utilizing the ITS region to design a genus-specific primers used for future detecting, monitoring and quantifying Trichoderma.

Fungal strains DNA extraction

11 Trichoderma species and 13 Non-Trichoderma strains utilized in this study were obtained from Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, and Department of Plant Pathology, College of Agriculture, Sichuan Agricultural University (Table 1). The GenBank numbers of the strains see Table 1. Total DNA of these strains was extracted from pure cultures using the method as described by Thambugala et al. (2015). DNA concentrations were adjusted to 50 ng/µl and 10 ng/µl.

Table 1

Organisms for primers specificity tests
Isolates	Species		GenBank accession no.
Isolates	Species		ITS	tef1	rbp2
Trichoderma
Tafum2		T.afroharzianum	MT102402	MT081432	MT081442
Tasum66		T.asperellum	MT102403
Tghse7		T.ghanense	MT102398		MT118247
Thaum12		T.harzianum	MT102390	MT081433	MT118248
Thaum14		T.harzianum	MT102391	MT081434	MT118249
Tkoii25		T.koningii	MT102397
Tkois1		T.koningiopsis	MT102394	MT081435	MT081443
Tkois2		T.koningiopsis	MT102395	MT081436	MT118250
Tloum3		T.longibrachiatum	MT102396	MT081437	MT118251
Tpyle24		T.pyramidale	MT102399	MT081438	MT118255
Tsise129		T.sinense	MT102400	MT081439	MT118252
Tvien3		T.virens	MT102392	MT081441	MT118253
Tvien6		T.virens	MT102393	MT081440	MT118254
JZ-67		Trichoderma sp.	HQ637333
Non-Trichoderma
JZ-5		Penicillium montanense	HQ637346
JZ-26		Mortierella minutissima	HQ637328
JZ-62		Aspergillus versicolor	HQ637361
Mht-5		Lasiodiplodia theobromae	JQ658976
Mht-18		Botryosphaeria dothidea	JN662929
XCSY1		Cladosporium tenuissimum	MG873077
HNCS015		Colletotrichum scovillei	KX673575
Di7		Diaporthe sp.	MT102322
Gif5		Gibberella fujikuroi	MT102320
Glt16		Gloeotinia temulenta	MT102321
Nio6		Nigrospora oryzae	MT102319
Pem9		Pestalotiopsis mangiferae	MT102323
Phc3		Phyllosticta capitalensis	MT102324

Table 2

Design of species/genus-specific primers for the identification of three *Trichoderma* species and *Trichoderma* genus fungi
Organism	Gene	Primers	Sequence(5'–3')	Product size
T.harzianum	tef1	EHarF2/EHarR2	TCTGCTTCGCTCTTACTGC/TGTGTGAAGTTGATGGAAAG	253 bp
T.koningiopsis	tef1	EKoisF/EKoisR	CAAAATGCACTCRTTCAA/TGATTTCGACATGTCAAGAGCCAGG	255 bp
T.virens	tef1	EVireF/EVireR	ACCTCGCTGCTCTTTGCCATCGT/GCTGGATGAATGGGACGAGA	263 bp
Trichoderma spp.	ITS	ITricF/ITricR	GAACCCCTCCGGGGGGHC/TGTGCAAACTACTGCGCAKGA	103–113 bp

Primer Designing

Species-specific primers were designed based on the sequences data of the tef1 genes, the reference tef1 sequences of 80 different Trichoderma species which are according to previous publications and 50 different Non-Trichoderma genera were obtained from NCBI (http://www.ncbi.nlm.nih.gov/) (Jaklitsch 2009; Samuels et al. 2012; Jaklitsch and Voglmayr 2015; Dou et al. 2018; Du Plessis et al. 2018). The genus-specific primers of Trichoderma were designed based on the sequences of rDNA ITS region, the reference sequences of ITS region of 50 different Trichoderma species which are according to previous publications and 65 different Non-Trichoderma genera were retrieved from NCBI (http://www.ncbi.nlm.nih.gov/) (Jaklitsch 2009; Jaklitsch and Voglmayr 2015; Dou et al. 2018; Du Plessis et al. 2018). All fungal tef1 or ITS sequences alignment was performed using ClustalX (1.7) software to find the polymorphic areas of target Trichoderma species or Trichoderma spp. relative to other fungi, and manually design primers based on the polymorphic areas. The species/genus-specific primers see Table 2. Primer specificity was first analyzed online in the Primer-BLAST tool of NCBI.

Pcr Conditions

PCR with different denaturation and annealing temperatures, and different extension time was performed for different specific primers pairs.

The conventional PCR reaction mixtures (25 µl) contained: 9.5 µl of sterile deionized water, 12.5 µl of 2 × Taq PCR Mastermix (0.05 units/µl Taq DNA polymerase ; 4 mM MgCl2, and 0.4 mM dNTPs) (Sangon Biotech, Shanghai, China), 1 µl of genomic DNA (50 ng/µl or 10 ng/µl), 1 µl of each primer (10 Mm).

The PCR parameters of EVireF/EVireR and EKoisF/EKoisR were 95 ℃ for 3 min, followed by 35 cycles of 95 ℃ for 30 s, 58 or 66 ℃ for 30 s (EKoisF/EKoisR is 58 ℃; EVireF/EVireR is 66 ℃), and 72 ℃ for 30 s. The PCR parameters of EHarF/EHarR were 95 ℃ for 3 min, followed by 35 cycles of 95 ℃ for 30 s, 61 ℃ for 30 s, 72 ℃ for 30 s, and the final extension step was at 72 ℃ for 5 min. The PCR parameters of ITricF/ITricR were 95 ℃ for 3 min, followed by 40 cycles of 95 ℃ for 30 s, 68 ℃ for 60 s, 72 ℃ for 90 s, and the final extension step was at 72 ℃ for 5 min. The amplified products were resolved by electrophoresis on 1.5% agarose gel, and stained with GoldView, and visualized under UV light.

If the specific primer does not produce non-specific products in conventional PCR amplification, the primer will be used for quantitative PCR amplification to further test its specificity. The real-time PCR were performed in the QuantStudio™ 6 Flex real-time PCR system (Life Technologies), and the reaction mixtures (25 µl) contained: 9 µl of nuclease-free water, 12.5 µl of SYBR-green PCR Master mix (Tiangen Biotech, Beijing, China), 1 µl of genomic DNA (10 ng/µl), 1 µl of each primer (10 Mm), 0.5 µl of 50X ROX dye.

The real-time PCR parameters of ITricF/ITricR were 95 ℃ for 15 min, followed by 40 cycles of 95 ℃ for 10 s, 62 ℃ for 30 s, and a melting curve of 95 ℃ for 15 s followed by 1 min at 60 ℃ with a final ramp to 95 ℃ with continuous data collection to test for primer dimers and non-specific amplification.

In this study, three sets species-specific primers were designed based on tef1 genes for rapid identification of Trichoderma harzianum, T.virens, and T. koningiopsis. The genus-specific primers were designed based on ITS sequences for detection and quantification of Trichoderma spp. under soil or other natural conditions.

PCR with the EHarF2/EHarR2 primers gave a single band of 253 bp for T. harzianum (Fig. 1a), and other Trichoderma species and fungi failed to amplify band on this set. But, the EHarF2/EHarR2 could amplify a more than 500 bp band from T. ghanense (Fig. 1a, Lane 7). The EKoisF/EKoisR primers could amplify a target amplicons of 255 bp from only the T. koningiopsis (Fig. 1b). However, the primers also could produce clear and obvious DNA bands of more than 500 bp from Cladosporium tenuissimum, Colletotrichum scovillei, and Diaporthe sp. (Fig. 1b, Lane 18, Lane 19 and Lane 20). The T. virens-specific primers EVireF/EVireR gave an amplicon of 263 bp for T. virens, and no amplicon was observed with the other representative strains on this set (Fig. 1c), but, this primer pair also amplify a more than 500 bp band from T. sinense (Fig. 1c, Lane 9).

The experimental results show that although EHarF2/EHarR2, EKoisF/EKoisR and EVireF/EVireR can only amplify target bands on the target Trichoderma species, however these primers can also amplify non-target bands on other fungi. Therefore, these three primers pairs can only be used for species identification and not for quantitative analysis.

The ITricF/ITricR primers could amplify a single band of 103–111 bp for 11 Trichoderma species, and none of these other fungal taxa produced any visible band (Fig. 2a). The melting curve analysis showed that there was only a single peak at Real-Time PCR amplification with ITricF/ITricR primers pair (Fig. 2b). The Real-Time PCR products were checked by agarose gel electrophoresis, and no band was observed with the no-Trichoderma genus fungi. The result was shown that the ITricF/ITricR primers could amplify DNA only from Trichoderma genus, and could use for Real-Time PCR amplification.

Using Primer-BLAST online tool analyzes the cross-reactivity of primers with fungi group to confirm primers specificity (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). The results shown that the EHarF2/EHarR2, EKoisF/EKoisR, EVireF/EVireR, and ITricF/ITricR primers pairs were no cross-reactivity with DNA of non-target species (see Additional file 1: Figs.S1, S2, S3, and S4).

Most Trichoderma species were as biocontrol fungus widely using to control soil-borne diseases. In order to rapidly identify Trichoderma species, species-specific primers pairs such as Th1F/Th1R for T. harzianum, Z04_2F/Z04_2R for T. atroviride, and Tc_RIF/ T_RIR for T. citrinoviride were developed in recently years (Prabhakaran et al. 2015; Skoneczny et al. 2015; Saroj et al. 2015).

In the present study, we designed 3 specific primer pairs EVireF/EVireR for T. virens, EHarF2/EHarR2 for T. harzianum and EKoisF/EKoisR for T. koningiopsis based on the tef1 gene, and designed primers ITricF/ITricR according to the ITS region which can amplify all species of Trichoderma but no other genera. These primers were analyzed by a primer-blast online tool and found to be cross-reactivity with non-target species/genera. The operation is simple, and only one routine PCR is needed to obtain a stable experimental effect, which provides a possibility for rapid identification of T. harzianum, T. virens, T. koningiopsis and Trichoderma genus, respectively. High densities of Trichoderma spp. can effectively suppress pathogens in soil (Qiu et al. 2012; Oskiera et al. 2017). So, monitoring the quantity of Trichoderma in soil can provide a scientific basis for increasing or no to apply Trichoderma on soil. At present, Real-Time PCR is a popular and economical tool to quantify microorganism in samples. In this study, ITricF/ITricR primers produced only one single peak at RT-PCR reaction, which indicating that a system for detecting the quantity of Trichoderma in soil or other environment can be developed in the future using the primers and its RT-PCR reaction conditions.

In conclusion, the species-specific primers EHarF2/EHarR2, EKoisF/EKoisR and EVireF/EVireR can meet the requirement for rapid identification the T. harzianum, T. koningiopsis and T. virens. Moreover, on future application, ITricF/ITricR primers can use to development a method for detection the quantity of Trichoderma in artificial or natural environment.

tef1

translation elongation factor 1-alpha

ITS

internal transcribed spacer

rpb2

RNA polymerase II subunit

acl1

ATP citrate lyase

T. harzianum

Trichoderma harzianum

T. virens

Trichoderma virens

T. koningiopsis

Trichoderma koningiopsis

Acknowledgments

We are grateful to Yong Kang at Hainan University, and Guiting Tang at Sichuan Agricultural University for helping to modify manuscript.

Authors’ contributions

Resources, methodology, funding acquisition, writing—review and editing: YZ; Resources, data curation, writing—original draft: JW; Formal analysis, validation: LY; Data curation, formal analysis: LG; Formal analysis, writing—original draft: SH; Validation, writing—review and editing, funding acquisition: WZ; Conceptualization, supervision, project administration: JH. All authors read and approved the final manuscript.

Funding

This study was supported by Hainan Provincial Natural Science Foundation of China (318QN272); and Central Public-interest Scientific Institution Basal Research Fund for Chinese Academy of Tropical Agricultural Sciences (1630042019038; 2017hzs1J001); and Science and Technology Major Project of Guangxi(AA18118028).

Availability of data and materials

All data and material generated or analysed during this study are included in this published article.

Ethics approval and consent to participate

This article does not contain studies with human participants or animals by any of the authors.

Consent for publication

The authors declare that they agree for publication.

Competing interests

The authors declare that they have no conflict of interest.

Author details

¹Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, Hainan, People’s Republic of China. ²Qiongzhong Lvyuan Ecological Agriculture Development Co., Ltd., Qiongzhong 572900, Hainan, People’s Republic of China. ³Biotechnology Research Institute, Guangxi Academy of Agricultural Sciences, Nanning 530007, Guangxi, People’s Republic of China.

Błaszczyk L, Popiel D, Chełkowski J, Koczyk G, Samuels GJ, Sobieralski K, Siwulski M (2011) Species diversity of Trichoderma in Poland. J Appl Genet 52(2):233-243 https://link.springer.xilesou.top/article/10.1007/s13353-011-0039-z

Contreras-Cornejo HA, Macías-Rodríguez L, del-Val E, Larsen J (2016) Ecological functions of Trichoderma spp. and their secondary metabolites in the rhizosphere: interactions with plants. FEMS Microbiol Ecol 92(4):fiw036 https://academic.oup.com/femsec/article/92/4/fiw036/2197739

Daguerre Y, Siegel K, Edel-Hermann V, Steinberg C (2014) Fungal proteins and genes associated with biocontrol mechanisms of soil-borne pathogens: a review. Fungal Biol Rev 28(4):97-125 https://sciencedirect.xilesou.top/science/article/abs/pii/S174946131400030X

Daryaei A, Jones EE, Glare TR, Falloon RE (2016) pH and water activity in culture media affect biological control activity of Trichoderma atroviride against Rhizoctonia solani. Biol Control 92:24-30 https://sciencedirect.xilesou.top/science/article/abs/pii/S1049964415300232

Daryaei A, Jones EE, Glare TR, Falloon RE (2016) Nutrient amendments affect Trichoderma atroviride conidium production, germination and bioactivity. Biol Control 93: 8-14 https://sciencedirect.xilesou.top/science/article/abs/pii/S1049964415300475

Dou K, Lu Z, Wu Q, et al. (2018) A novel polyphasic identification system for genus Trichoderma. bioRxiv 481382 https://www.biorxiv.org/content/10.1101/481382v1.full.pdf+html

Du Plessis IL, Druzhinina IS, Atanasova L, Yarden O, Jacobs K (2018) The diversity of Trichoderma species from soil in South Africa, with five new additions. Mycologia 110(3): 559-583 https://www.tandfonline.xilesou.top/doi/abs/10.1080/00275514.2018.1463059

Friedl MA, Druzhinina IS (2012) Taxon-specific metagenomics of Trichoderma reveals a narrow community of opportunistic species that regulate each other’s development. Microbiology 158(Pt 1):69 https://www.ncbi.xilesou.top/pmc/articles/PMC3352360/

Gajera HP, Savaliya DD, Patel SV, Golakiya BA (2015) Trichoderma viride induces pathogenesis related defense response against rot pathogen infection in groundnut (Arachis hypogaea L.). Infect Genet Evol 34:314-325 https://sciencedirect.xilesou.top/science/article/abs/pii/S1567134815002658

Hagn A, Wallisch S, Radl V, Munch JC, Schloter M (2007) A new cultivation independent approach to detect and monitor common Trichoderma species in soils. J Microbiol Meth 69(1):86-92 https://sciencedirect.xilesou.top/science/article/pii/S0167701206003502

Huang X, Chen L, Ran W, Shen Q, Yang X (2011) Trichoderma harzianum strain SQR-T37 and its bio-organic fertilizer could control Rhizoctonia solani damping-off disease in cucumber seedlings mainly by the mycoparasitism. Appl Microbiol Biot 91(3): 741-755 https://link.springer.xilesou.top/article/10.1007/s00253-011-3259-6

Jaklitsch WM (2009) European species of Hypocrea Part I. The green-spored species. Stud Mycol 63:1-91 https://sciencedirect.xilesou.top/science/article/pii/S0166061614600907

Jaklitsch WM, Voglmayr H (2015) Biodiversity of Trichoderma (Hypocreaceae) in Southern Europe and Macaronesia. Stud Mycology 80:1-87 https://sciencedirect.xilesou.top/science/article/pii/S0166061614000505

Kataoka R, Yokota K, Goto I (2010) Biocontrol of yellow disease of Brassica campestris caused by Fusarium oxysporum with Trichoderma viride under field conditions. Archives Phytopathol Plant Protect 43(9):900-909 https://www.tandfonline.xilesou.top/doi/abs/10.1080/03235400802075583

Kredics L, Chen L, Kedves O, et al. (2018) Molecular tools for monitoring Trichoderma in agricultural environments. Front Microbiol 9:1599 https://www.frontiersin.org/articles/10.3389/fmicb.2018.01599/full

Lehmann L, Rønnest NP, Jørgensen CI, Olsson L, Stocks SM, Jørgensen HS, Hobley T (2016) Linking hydrolysis performance to Trichoderma reesei cellulolytic enzyme profile. Biotechnol Bioeng 113(5):1001-1010 https://onlinelibrary.wiley.xilesou.top/doi/abs/10.1002/bit.25871

Meincke R, Weinert N, Radl V, Schloter M, Smalla K, Berg G (2010) Development of a molecular approach to describe the composition of Trichoderma communities. J microbiol meth 80(1):63-69 https://sciencedirect.xilesou.top/science/article/pii/S0167701209003522

Moreno CA, Castillo F, González A, et al (2009) Biological and molecular characterization of the response of tomato plants treated with Trichoderma koningiopsis. Physiol Mol Plant P 74(2):111-120 https://sciencedirect.xilesou.top/science/article/abs/pii/S0885576509000654

Nawrocka J, Małolepsza U (2013) Diversity in plant systemic resistance induced by Trichoderma. Biol Control 67(2):149-156 https://sciencedirect.xilesou.top/science/article/abs/pii/S1049964413001539

Oskiera M, Szczech M, Stępowska A, Smolińska U, Bartoszewski G (2017) Monitoring of Trichoderma species in agricultural soil in response to application of biopreparations. Biol Control 113:65-72 https://sciencedirect.xilesou.top/science/article/abs/pii/S1049964417301391

Prabhakaran N, Prameeladevi T, Sathiyabama M, Kamil D (2015) Multiplex PCR for detection and differentiation of diverse Trichoderma species. Ann Microbiol 65(3):1591-1595 https://link.springer.xilesou.top/article/10.1007/s13213-014-0998-5

Qiu M, Zhang R, Xue C, Zhang S, Li S, Zhang N, Shen Q (2012) Application of bio-organic fertilizer can control Fusarium wilt of cucumber plants by regulating microbial community of rhizosphere soil. Biol Fert Soils 48(7):807-816 https://link.springer.xilesou.top/article/10.1007/s00374-012-0675-4

Samuels GJ, Ismaiel A, Mulaw TB, Szakacs G, Druzhinina IS, Kubicek CP, Jaklitsch WM (2012) The Longibrachiatum clade of Trichoderma: a revision with new species. Fungal divers 55(1):77-108 https://link.springer.xilesou.top/article/10.1007/s13225-012-0152-2

Saroj DB, Dengeti SN, Aher S, Gupta AK (2015) A rapid, one step molecular identification of Trichoderma citrinoviride and Trichoderma reesei. World J Microb Biot 31(6):995-999 https://link.springer.xilesou.top/article/10.1007/s11274-015-1839-9

Skoneczny D, Oskiera M, Szczech M, Bartoszewski G (2015) Genetic diversity of Trichoderma atroviride strains collected in Poland and identification of loci useful in detection of within-species diversity. Folia Microbiol 60(4):297-307 https://link.springer.xilesou.top/article/10.1007/s12223-015-0385-z

Sun J, Pei Y, Li E, Li W, Hyde KD, Yin WB, Liu X (2016) A new species of Trichoderma hypoxylon harbours abundant secondary metabolites. Sci Rep-UK 6:37369 https://www.nature.xilesou.top/articles/srep37369

Taghdi Y, Hermosa R, Dominguez S, Rubio MB, Essalmani H, Nicolas C, Monte E (2015) Effectiveness of composts and Trichoderma strains for control of Fusarium wilt of tomato. Phytopathol Mediterr 54(2):232-240 https://www.jstor.org/stable/43871831

Thambugala KM, Hyde KD, Tanaka K, et al. (2015) Towards a natural classification and backbone tree for Lophiostomataceae, Floricolaceae, and Amorosiaceae fam. nov. Fungal Divers 74(1):199-266 https://link.springer.xilesou.top/article/10.1007/s13225-015-0348-3

Vinale F, Sivasithamparam K, Ghisalberti EL, Marra R, Woo SL, Lorito M (2008) Trichoderma–plant–pathogen interactions. Soil Biol Biochem 40(1):1-10 https://sciencedirect.xilesou.top/science/article/abs/pii/S0038071707002908

Woo SL, Ruocco M, Vinale F, et al. (2014) Trichoderma-based products and their widespread use in agriculture. Open Mycol J 8(1):71-126 https://benthamopen.com/ABSTRACT/TOMYCJ-8-71

Zhu ZX, Zhuang WY (2015) Trichoderma (Hypocrea) species with green ascospores from China. Persoonia 34:113-129 https://www.ncbi.xilesou.top/pmc/articles/PMC4510275/

supplementarymaterial.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Development of Species/Genus specific Primers for Identification of Three Trichoderma Species and for Detection of Trichoderma Genus

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Fungal strains DNA extraction

Primer Designing

Pcr Conditions

Results

Discussion

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1