Isolation and culture of rat BMSCs
Bone marrow stem cells were isolated from Sprague-Dawley rats (Experimental animal center of Nanfang Hospital,male or female, 80–100g. All rats were killed by cervical dissection, and the bodies were collected and burned by environmental health management department of Guangdong province.) by flushing the femurs and tibias with DMEM-LG medium (Gibco, Langley, OK, USA) supplemented with 10% defined fetal calf serum (Gibco), 100 U/ml penicillin, and 100 μg/ml streptomycin (North China Pharmaceutical Factory, China) (termed general medium, GM). Isolated cells were plated in the some medium on 25 cm2 flasks and incubated at 37 °C under a humidified atmosphere containing 5% CO2. After 24 h, non-adherent cells were removed by washing with PBS, and fresh GM was added to allow for further growth. The culture medium was changed every 2–3 days thereafter. When the cells reached 80%–90% confluence, they were washed with PBS, detached by 0.25% trypsin, and subcultured in new 25 cm2 flasks at 1 × 104 cells/cm2. Cells were collected at the second or third generation and sent for flow cytometry analysis (BD, Franklin Lakes, NJ, USA) of CD29, CD34, CD44, and CD45 expression for confirmation of BMSC phenotype [13, 14].
Induction of osteogenesis or adipogenic differentiation and delivery of mechanical stimuli
Bone marrow stem cells at the logarithmic growth phase were collected, washed, and resuspended in DMEM at 1×105 cells/ml. Cells were seeded onto Bioflex 6-well plates at 1.5–2 ml per well and incubated under 5% CO2 at 37 °C. Control cultures were refreshed with basal medium every 48 h. Differentiation of BMSCs was induced using the culture conditions previously described [19]. For osteogenic induction, cells were cultured in medium supplemented with 10% FBS, 1% penicillin/streptomycin, 100 nmol/L dexamethasone, 50 µmol/L ascorbic acid 2-phosphate, and 10 mmol/L β-glycerophosphate. For adipogenic induction, cells were cultured in DMEM containing 10% FBS, 1% penicillin/streptomycin, 1 μmol/L dexamethasone, 0.5 mmol/L IBMX, 10 mg/L insulin, and 200 µmol/L indomethacin. Mechanical stimulation parameters were set to 5% deformation rate, 0.5 Hz, and 6 h/d. The mechanical stretching device was updated to stimulate cells as previously described [20].
Alkaline phosphatase and oil red O staining
An ALP staining kit (Tiangen Biotech Co. Ltd., Beijing, China) was used for determination of osteogenic differentiation according to the manufacturer´s instructions. Briefly, cells were fixed with 4% paraformaldehyde in PBS for 12 min at room temperature then stained with 1–2 ml/well ALP solution for 30 min at room temperature. The solution was aspirated and the cells were washed with distilled water and observed under light microscopy for ALP-positive cells. For determination of adipogenic differentiation, cells were fixed with 10% neutral buffered formalin for 1 h at room temperature, incubated with 60% isopropanol for 1 min, and then stained with oil red O for 15 min. Positively stained lipid droplets (red) were visualized under light microscopy.
Western Blotting
Cells were lysed by incubation in RIPA buffer containing protease inhibitor cocktail (Roche, Shanghai, China) on ice for 30 min. Cell lysates were centrifuged at 12000 g for 5 min at 4°C, and the supernatant was collected. Protein concentration was determined using the Pierce BCA protein Assay Kit (Thermo Scientific, MD, USA). Total protein was separated by SDS-PAGE (25 µg per gel lane) and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, MA, USA). Membranes were blocked with 5% non-fat milk in TBST buffer and probed with primary antibodies against the osteogenic markers Runx2 (Biorbyt, CA, USA) and BMP2 (ab14933, Abcam) or the bone adipogenic markers PPARγ (ab45036, Abcam) and C/EBPα (ab40764, Abcam). In addition, membranes were incubated with anti-Smad2 (ab33875, Abcam), anti-TGFβ1 (ab179695, Abcam), and anti-TGFR1 (ab31013, Abcam) to assess expression of TGFβ1/Smad2 signaling pathway components. Subsequently, membranes were washed with TBST, and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (115-035-003 and 111-035-003 from Jackson Immuno Research Laboratories, West Grove, PA, USA). Target proteins were visualized using a ECL chemiluminescence kit (Pierce) and band densities quantified using ImageJ (National Institutes of Health, USA).
RNA Extraction and RT-PCR Analysis
The expression levels of osteoblastic and adipocyte genes were analyzed by quantitative real-time PCR. Briefly, BMSCs were harvested and RNA was extracted using Trizol Reagent. Total RNA was reverse transcribed to cDNA using kit K1622 (Thermo Scientific). Real-time PCR assays were performed using All-in-One™ qPCR reagents (Genecopoeia, Guangzhou, China) with specific primers. The primer sequences for the differentiation markers were as follows: Runx2-F, GGACCGACACAGCCATATAAA, Runx2-R, GCCTCATTCCCTAACCTGAAA; BMP2-F, CAGTGGGAGAGCTTTGATGT, BMP2-R, ACCTGGCTTCTCCTCTAAGT; PPARγ-F, GACCTGAAGCTCCAAGAATACC, PPARγ-R, TTCATGTGGCCTGTTGTAGAG; C/EBP-F, CCTCTGGGATGGATCGATTATG, C/EBP-R, GGGACCTTAGTTTCTGGTCTTG. The primer sequences for the TGFβ1/ Smad2 signaling pathway were as follows: Smad2-F, GAGCACGTGAGGTGAGATTT, Smad2-R, CTAAGGACTTCCAGAGGGAAAC; TGFβ1-F, GCAACAATTCCTGGCGTTAC, TGFβ1-R, GTATTCCGTCTCCTTGGTTCAG. TGFβr1-F, CTTCCTTGAGTCACTGGGTATC, and TGFβr1-R, CTTGGCTGTCACCCTAATCTT. The expression levels of target genes were normalized to expression of the GAPDH gene.
MiR-140-5p transient overexpression and inhibition
To assess the effects of miR-140-5p on differentiation, cells were transiently transfected with a vector encoding miR-140-5p mimic or inhibitor (GenePharma, Suzhou, China). Briefly, BMSCs were expanded in culture until 80% confluent, trypsinized, reseeded in 6-well Bioflex plates, washed with PBS, and treated with transfection medium containing riboFECT CP Reagent (RiboBio, Guangzhou, China) and 100 nm of either miR-140-5p mimic, inhibitor, or scrambled miR-NC (control) for approximately 48 h. Total RNA was then extracted for RT-PCR analysis and proteins were extracted for western blot analysis as described.
Luciferase assays of miR-140-5p expression
The putative target sites for miR-140-5p on the 3’-UTR of TGFβR1were predicted using bioinformatics tools. HEK293 cells were seeded on 24-well plates and cultured until 60% confluent. The cells were then transfected with a vector encoding wild type or mutated TGFβR1 3’-UTR using the X-treme GENE™ HP DNA Transfection Reagent. After incubation for 48 h, the cells were lysed in 1× Passive Lysis Buffer and luciferase activities measured using the Dual-Luciferase® Reporter Assay System (Promega, Madison, WI, USA) according to the manufacturer´s instructions.
Statistical analysis
All data shown are expressed as mean ± standard deviation (SD) of at least three independent experiments. Group means were compared by independent sample t-tests using Prism version 6 (GraphPad software). A p ≤ 0.05 (two-tailed) was considered statistically significant for all tests.