Animals
All animal experiments were performed on male, 8-10-week-old C57/BL6J wild-type (WT) mice. All animals were housed under a constant temperature and humidity and a 12 h light/12 h dark cycle. Food and water were available ad libitum. Study design and experimental protocols were approved by the ethics committee of the Affiliated Hospital of Yangzhou University (2020-YKL03-G029).
Transient middle cerebral artery occlusion (tMCAO)
To induce ischemia/reperfusion brain injury, tMCAO was performed as previously described[41]. Briefly, mice were anaesthetized with 3% isoflurane and maintained with 1.5% isoflurane in 30% oxygen and 70% nitrous oxide. Rectal temperature was maintained at 37.0±0.5ºc. A silicone rubber-coated 6-0 nylon filament (Doccol, Sharon, USA) was inserted into the exposed right external carotid artery and advanced over 9-10 mm to the carotid bifurcation and then along the internal carotid artery to the origin of the middle cerebral artery (MCA). At 1 h after the occlusion, the filament was removed to restore blood flow to the MCA territory. The same procedure was used in sham-operated mice, but no filaments were inserted. Sham-operated mice served as controls.
Neurological behavioral assessments
Neurological status was assessed 3 d after tMCAO using the modified neurological severity scores (mNSS) by a researcher blinded to the experimental groups. The score was graded on a scale of 0 to 14 (normal score, 0; maximum score, 14). One point is awarded for the inability to perform a test or for the lack of a tested reflex; thus, a higher score indicates a more severe injury.
The grid walking task was performed as previously described[42]. Mice walked on a 35 cm × 25 cm wire grid with 12 mm square mesh for 5 min. When left front paw passed through the grid hole, it was counted as one-foot fault. The ratio of foot faults was calculated. Ratio= (number of left foot faults/total number of left foot steps) ×100%.
Cell cultures
Primary mouse astrocyte cell cultures were prepared from brain tissues of postnatal day 1 or 2 of C57BL/6J mice. The brain membranes and vessels were mechanically separated by gauze, and the tissues were digested with trypsin-EDTA (Gibco, 25200056). Subsequently, the cells were plated on poly-L-lysine precoated cell culture flasks containing Dulbecco's modified Eagle's medium (DMEM; Corning, 32016001) supplemented with fetal bovine serum (10% v/v) and penicillin/streptomycin (1% v/v). The cultures were maintained in a humidified chamber (37ºc, 5% CO2 incubator). After 7 to 10 d, the astrocytes were harvested by trypsinization for transplantation.
Plasmid construction
Full length of FUS cDNA was cloned from mouse brain cDNA by PCR and then subcloned into the pEGFP-N1 vector to generate the WT FUS-pEGFP-N1 vector. The sequences of primers for generating WT FUS plasmid were as follows: forward primer 5’- GCTACCGGACTCAGATCTATGGCTTCAAACGACTAT-3’ and the reverse primer 5’- GGCGACCGGTGGATCCCGATATGGCCTCTCCCTGCG-3’. The truncated FUS (FUS ΔPrD.) Was generated by homologous recombination. The 5’ and 3’ homology arms for the FUS coding region were amplified by genomic DNA PCR using specific primer pairs (GCTACCGGACTCAGATCTATGAGTGACCGCGGTGGCTTC and ACACTTCCAGTCTCCAGCGAAGTCAGCTCGGCGGGT for the 5’ homology arm, ACCCGCCGAGCTGACTTCGCTGGAGACTGGAAGTGT and GGCGACCGGTGGATCCCGATATGGCCTCTCCCTGCG for the 3’ homology arm), and cloned into the mutant construction vector pegfp-N1. All constructs were confirmed by DNA sequencing.
Oxygen glucose deprivation reperfusion (OGD/R) treatment
To establish an ischemic-like condition in vitro, primary astrocytes were exposed to OGD/R condition as previously reported[43]. Briefly, primary astrocytes were cultured under normal conditions and then moved to deoxygenated DMEM without glucose and Fetal Bovine Serum (Gibco, 11966-025) in an incubator (Thermo Scientific, Waltham, USA) with premixed gas (95% N2 and 5% CO2) for 3 h. Finally, the cells were cultured in normal medium under normoxic conditions (95% air and 5% CO2) for reperfusion. Cells incubated in complete medium under a normoxic atmosphere were used as controls.
Immunostaining
Tissue sections were cut into 30 μm slices with a cryostat. The sections were then incubated with 0.3% Triton X-100 (Aladdin, T109027) in PBS for 15 min and blocked with 10% normal goat serum in 0.3% Triton X-100 for 1 h at room temperature. Next, the sections were incubated with a mouse anti-GFAP antibody (1:250; Sigma-Aldrich, G3893) overnight at 4ºc. Brain sections were incubated with mouse anti-GFAP antibody and rabbit anti-FUS antibody (1:500, Proteintech, 11570-1-AP) overnight at 4ºc for co-localization analysis. On the following day, the sections were washed and incubated with second antibodies for 1 h, Alexa Fluor 594-conjugated anti-mouse igg (1:250; Invitrogen, A11001), Alexa Fluor 488-conjugated anti-mouse igg (1:250; Invitrogen, A11008) and Alexa Fluor 594 goat anti-rabbit igg (1:250; Invitrogen, A11012) were used for target detection. After a final washing step with PBS, the sections were mounted on glass slides, and Prolong gold anti-fade reagent containing DAPI (Southern Biotech, 0100–20) was applied for visualization of nuclei.
Primary mouse astrocytes were cultured on coverslips 24 h before OGD/R treatment. Astrocytes were fixed with 4% paraformaldehyde in PBS, cells were washed twice with PBS and then incubated with 0.3% Triton X-100 (Aladdin, T109027) in PBS for 15 min at room temperature. Cells were blocked with 10% normal goat serum in 0.3% Triton X-100 for 1 h before staining. Cells were stained with antibodies against GFAP (1:250; Sigma-Aldrich, G3893), and FUS (1:500, Proteintech, 11570-1-AP). Alexa Fluor 594-conjugated anti- mouse igg (1:250; Invitrogen, A11001) and Alexa Fluor 488 goat anti-rabbit igg (1:250; Invitrogen, A11012) were used for target detection. DAPI (Southern Biotech, 0100–20) was employed to stain cell nuclei.
Immunofluorescence images were captured by microscopy (OLYMPUS, Tokyo, Japan, DP73). The images of GFAP staining were captured using a microscope (Zeiss, Oberkochen, Germany, imagerm2). Computer-based cell tracing software Neurolucida 360 (MBF Bioscience, Williston, VT, USA) was used for three-dimensional (3D) reconstruction of GFAP+ cells within the cerebral cortex. Sholl analysis was used to determine branch tree morphology by placing three dimensional concentric circles in 5 mm increments starting at 5 mm from the soma.
Western blot
Bran tissues or cultured astrocytes were lysed in RIPA lysis buffer (Beyotime, Jiangsu, China; P0013B) with protease inhibitor cocktail and centrifuged at 12,000 rpm for 30 min at 4 °C to remove the insoluble cell debris. The protein concentrations from cell lysates were measured with a BCA protein assay kit (NCM Biotech, China). The extracted proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and electrophoretically transferred to polyvinylidene fluoride membranes (Millipore, MA). The membranes were blocked with 5% nonfat dry milk in Tris-buffered saline with Tween-20 (Aladdin, Shanghai, China; T104863), probed with antibodies overnight at 4°C, and then incubated with a horseradish peroxidase-conjugated goat anti-mouse (ZSGB-BIO, Beijing, China; ZB5305) or rabbit (ZSGB-BIO, ZB5301) IgG secondary antibody (1:2000). Antibodies against the following proteins were used: anti-GFAP (G3893), anti-LC3B (L7543) obtained from Sigma-Aldrich, anti-GAPDH (60004), anti-FUS (11570-1-AP), acquired from Proteintech.
Isolation of FUS aggregation
Aggregated FUS was obtained by a method previously described[44, 45]. Tissues and primary mouse astrocytes were lysed in a lysis buffer containing a protease and phosphatase inhibitor cocktail. The lysate was centrifuged at 10000g for 10 min at 4ºc to obtain the supernatant, followed by high-speed centrifugation at 100000g for 1 h at 4ºc. The supernatant contained free FUS protein. The pellets were resuspended in 2% Triton X-100 and 150 mmol/ KCl and then sonicated with 20% amplitude for 10 seconds at 4°C, followed by rotating for 1 h at 4ºc. After centrifuging at 10000g for 10 min at 4ºc, the pellets containing aggregated FUS protein were resuspended in sodium dodecyl sulfate (SDS) and buffer and sonicated. The expression of aggregated FUS was determined by western blot analysis.
Statistics
The data are presented as the mean±SD. Unpaired t-tests were used for two-group comparisons. One- or two-way ANOVA followed by Holm-Sidak tests was used for comparisons of three or more groups. Data are presented as mean ± standard error of the mean. The results were statistically significant if p<0.05 by analysis of variance.