2.1. Reagents and antibodies
Recombinant murine soluble RANKL (315 − 11) was purchased from Peprotech. Chloroquine (CQ) phosphate (S4157) was obtained from Selleck. ML171 (492002) was acquired from Millipore Corporation. Diphenyleneiodonium chloride (DPI) (sc-202584) and 5-O-methyl quercetin (sc-483298) were purchased from Santa Cruz Biotechnology. N-acetyl-L-cysteine (NAC) (A9165) and Mito-TEMPO (SML0737) were purchased from Sigma-Aldrich. GSK2795039 (HY-18950) and GSK2606414 (HY-18072) were provided by MCE.
Both the mouse Nox4 short hairpin RNA (shRNA)-containing retrovirus and the corresponding empty vector were designed and synthesized by HanBio (Shanghai, China). The mRFP-GFP-LC3-containing adenovirus (HB-AP210 0001) was provided by HanBio. Primary antibodies against Nox3 (20065-1-AP), Nox4 (14347-1-AP), ATF6 (24169-1-AP), ATF4 (10835-1-AP), XBP1S (24868-1-AP), GAPDH (60004-1-Ig), ERp57/ERp60 (15967-1-AP) and VDAC1/Porin (55259-1-AP) were obtained from Proteintech. Primary antibodies against LC3A/B (4108S), PERK (C33E10) (3192S), phospho-PERK (Thr980; 16F8) (3179S), eIF2α (D7D3) XP® (5324T) and phospho-eIF2α (Ser51; D9G8) XP® (3398T) were purchased from Cell Signaling Technology. Primary antibodies against Nox1 (ab131088) and Nox2/gp91phox (ab129068) were obtained from Abcam.
2.2. Cell culture
The RAW264.7 mouse monocyte/macrophage cell line was purchased from the Cell Culture Center of the Chinese Academy of Sciences (Shanghai, China) and cultured in Dulbecco’s modified Eagle’s medium (Gibco, 11995065) supplemented with 10% fetal bovine serum (Gibco, 10091148). Containing 100 U/mL penicillin and 100 mg/mL streptomycin (Gibco, 15070063). The cells were incubated in a humidified atmosphere with 95% air and 5% CO2 at 37 °C. To induce osteoclast differentiation, RAW264.7 cells were stimulated with 100 ng/mL RANKL and further cultured for the indicated times.
2.3. Retrovirus-mediated stable knockdown of Nox4
RAW264.7 cells were plated and cultured in 35-mm dishes. When the confluence reached 50%, the cells were transfected with retrovirus encoding Nox4 shRNAs or scrambled shRNA at a multiplicity of infection (MOI) of 100 for 24 h according to the manufacturer’s instructions. The nucleotide sequences were as follows: sh-Nox4-1, 5′-GCAGGAGAACCAGGAGATTGT-3′; sh-Nox4-2, 5′-GCATGGTGGTGGTGCTATT CC-3′; sh-Nox4-3, 5′-GGTATACTCATAACCTCTTCT-3′; and sh-NC, 5′-TTCTCCGAA CGTGTCACGT-3′. RAW264.7 cells with stable knockdown of Nox4 expression were screened by the addition of 2 µg/mL puromycin to the culture medium for 48 h. Then, the stable cells were digested with 0.25% trypsin and seeded on 35-mm dishes at a density of 8 × 104 cells/dish and incubated overnight for attachment. The next day, adherent cells were treated with or without RANKL (100 ng/mL) for 3 days. The knockdown efficiency of the three Nox4 shRNAs was measured using western blotting, and the most effective was selected for use in subsequent experiments.
2.4. Osteoclast differentiation assay
Osteoclast formation was measured by quantifying cells positively stained with TRAP. Briefly, RAW264.7 cells were incubated at a density of 1 × 104 cells/well in 24-well plates overnight. After stimulation with RANKL (100 ng/mL) and various concentrations of different pharmacological reagents for 6 days, the cells were fixed with 4% paraformaldehyde for 30 min at room temperature and then stained by using a Tartrate Resistant Acid Phosphatase Assay Kit (Beyotime Biotechnology, P0332) according to the manufacturer's instructions. TRAP-positive and multinucleated cells containing three or more nuclei were considered osteoclasts. For each well, the osteoclasts were observed under a light microscope (Leica, Wetzlar, Germany).
2.5. Osteoclast bone resorption pit formation assay
To confirm the bone resorption ability of differentiated osteoclasts, RAW264.7 cells were seeded at a density of 2 × 104 cells/well overnight in 24-well Osteo Assay Surface plates (Corning, New York, NY, USA) coated with hydroxyapatite matrix. Then, the cells were incubated with RANKL (100 ng/mL) or in the presence of various concentrations of different pharmacological reagents. The medium was replaced every 3 days. After 7 days of culture, the cells were removed using a 10% sodium hypochlorite solution, and the wells were stained with 1% toluidine blue. The plate was washed twice with distilled water and air dried at room temperature. The areas of bone resorption pits in each well were determined using a light microscope (Leica).
2.6. Quantitative real-time PCR (qRT-PCR)
Total cellular RNA was extracted using RNAiso plus reagent (Takara, 9108) according to the manufacturer’s instructions. Subsequently, the total RNA concentration was determined with a NanoDrop 2.0 spectrophotometer (Thermo Fisher Scientific, Pittsburgh, PA, USA), and the RNA was reverse transcribed to cDNA using a PrimeScript™ RT reagent kit with gDNA Eraser (Takara, RR047A) according to the manufacturer’s instructions. Subsequently, qRT-PCR assays were performed by using a SYBR Premix Ex Taq™ II (2×) kit (Takara, RR820A) according to the manufacturer’s instructions and run on an ABI 7500 Real-Time PCR Detection System (Foster City, CA, USA). The reactions were performed using the following parameters: 95 °C for 30 s followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The primer nucleotide sequences used for PCR are listed in Table 1. All primer sets for mRNA amplification were purchased from Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China). The relative expression levels of the target gene were normalized with respect to the levels of β-actin expression and calculated using the 2−△△CT method.
Table 1
Primer sequences used for real-time quantitative PCR
Gene | Sequence (5′ to 3′) | Amplicon size (bp) |
TRAP | Forward: ACTTGCGACCATTGTTAGCCACAT | 91 |
Reverse: ACACCGTTCTCGTCCTGAAGATACT |
MMP-9 | Forward: CCAGTATCTGTATGGTCGTGGCTCTA | 82 |
Reverse: AGGTGCTGTCGGCTGTGGTT |
Cath K | Forward: AGGATATGCTCTCTTGGCTCGGAAT | 91 |
Reverse: GCTGGCTGGCTGGAATCACATC |
β-actin | Forward: TCACTATTGGCAACGAGCGGTTC | 153 |
Reverse: GCACTGTGTTGGCATAGAGGTCTT |
2.7. Transmission electron microscopy (TEM)
RAW264.7 cells were cultured with the indicated treatments for 3 days. Then, the cells were digested with 0.25% trypsin, centrifuged (2000 rpm) for 10 min and fixed with 2.5% glutaraldehyde overnight at 4 °C. Subsequently, the cells were postfixed with 1% osmium tetroxide for 1.5 h, washed and stained in 3% aqueous uranyl acetate for 1 h. Thereafter, the samples were washed again, dehydrated with a graded series of increasing ethanol concentrations to 100% and embedded in Epon-Araldite resin. Subsequently, the ultrathin sections were cut using a Reichert ultramicrotome (Reichert, New York, NY, USA) and counterstained with 0.3% lead citrate. Then, the ultrastructure of autophagic vacuoles (autophagosomes and autolysosomes) was observed under a Philips EM420 transmission electron microscope (Philips, UK), and images were captured.
2.8. Autophagic flux assessment
After growth to 50% confluence in 35-mm dishes, the cells were transfected with adenovirus expressing mRFP-GFP-LC3 (HanBio) for 24 h using a multiplicity of infection of 1000, according to the manufacturer’s instructions. Then, the cell growth medium was replaced with fresh complete medium for another 24 h. Afterward, the transfected cells were digested with 0.25% trypsin and seeded on confocal Petri dishes (NEST, Wuxi, Jiangsu, China) at a density of 5 × 104 cells/dish and incubated overnight for attachment. Thereafter, adherent cells were treated with the various indicated treatments for 3 days. The treated cells were washed with phosphate buffer saline (PBS) and viewed with a laser scanning confocal microscope (Leica). GFP loses its fluorescence in acidic lysosomal conditions, whereas mRFP does not. Therefore, yellow (merged GFP signal and RFP signal) puncta represent early autophagosomes, whereas puncta detectable only as red (RFP signal alone) indicate late autolysosomes that are formed by autophagosome fusion with lysosomes. Autophagic flux was ultimately assessed by quantifying the mRFP and GFP puncta per cell. The number of GFP and mRFP puncta was determined by manually counting 30 cells randomly in 5 fields per dish, and the average number of puncta per cell was calculated.
2.9. ER-Tracker staining in living cells
RAW264.7 cells (5 × 104) were plated on confocal Petri dishes (NEST) and allowed to attach overnight. Then, the cells were cultured with the indicated treatments for the indicated times. Next, ER-Tracker (Thermo Fisher Scientific, E34250) was added directly to the culture medium at 500 nM and incubated with cells for 30 min in a 37 °C humidified incubator containing 5% CO2. Then, the cells were washed with PBS and immediately observed under a laser scanning confocal microscope (Leica).
2.10. Immunofluorescence staining for Nox4 localization
The colocalization of Nox4 with the ER was detected by double-labeling immunofluorescence. Briefly, RAW264.7 cells were seeded on confocal Petri dishes (NEST) at a density of 5 × 104 cells/dish overnight. Then, the cells were incubated with or without RANKL (100 ng/mL) for 3 days. Thereafter, the cells were stained with ER-Tracker (the detailed experimental procedure is described in step 2.9) and fixed in 4% paraformaldehyde for 20 min at 37 °C. Then, the cells were permeabilized with 0.1% Triton X-100 for 10 min and blocked with 10% normal goat serum for 1 h at 37 °C. Subsequently, the cells were incubated with a rabbit polyclonal anti-Nox4 antibody (1:25) in a humidified chamber at 4 °C overnight. Then, the cells were washed and incubated with Alexa Fluor 488-labeled goat anti-rabbit IgG (1:500), (Beyotime Biotechnology, A0423) for 1.5 h at 37 °C in the dark. DAPI Staining Solution (Beyotime Biotechnology, C1005) was used to counterstain the cell nuclei. Finally, the cells were observed using a laser scanning confocal microscope (Leica).
2.11. Subcellular fractionation assay
RAW264.7 cells were seeded in 6-cm dishes overnight. Then, the cells were cultured with the indicated treatments for the indicated times. Subsequently, the cells were digested with 0.25% trypsin and centrifuged (1000 rpm) for 5 min. Mitochondria and the ER were extracted from cells using a Cell Mitochondria Isolation kit (Beyotime Biotechnology, C3601) and Endoplasmic Reticulum Isolation kit (BestBio Science, BB-31454-1) according to the manufacturer’s instructions. The fractions of mitochondria and ER were lysed in RIPA buffer (Beyotime Biotechnology, P0013) that contained a protease and phosphatase inhibitor cocktail (Beyotime Biotechnology, P1050) for subsequent western blot analysis.
2.12. Western blot analysis
RAW264.7 cells were lysed in RIPA buffer that contained a protease and phosphatase inhibitor cocktail. After centrifugation at 14000 × g for 5 min at 4 °C, the concentrations of protein were measured using a BCA protein assay kit (Beyotime Biotechnology, P0010). Subsequently, equal amounts of protein (40 µg) were separated by 6%, 8% or 12%/5% (w/v) sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Bio-Rad, Hercules, CA, USA) and transferred to polyvinylidene difluoride membranes. The membranes were incubated with anti-GAPDH, anti-Nox4, anti-LC3A/B, anti-ERp57/ERp60, anti-VDAC1/Porin, anti-Nox3, anti-Nox2/gp91phox, anti-Nox1, anti-PERK (C33E10), anti-phospho-PERK (Thr980) (16F8), anti-ATF6, anti-ATF4, anti-XBP1S, anti-eIF2α (D7D3) XP® and anti-phospho-eIF2α (Ser51; D9G8) XP® antibodies separately overnight at 4 ℃. Then, the membranes were incubated with horseradish peroxidase-conjugated goat anti-mouse/rabbit IgG (H + L) secondary antibodies (1:5000) (ZSGB-BIO, ZB-2305/ZB-2301) for 1 h at room temperature. Finally, the protein bands of interest on the membranes were visualized with a chemiluminescence substrate kit (Millipore Corporation, WBKLS0100) using an Image Quant LAS4000 instrument (GE, UK). The band intensity was quantified by densitometric analysis using Image J software (National Institutes of Health, Bethesda, MD, USA).
2.13. Determination of intracellular and ER ROS
The intracellular production of ROS was detected by staining cells with a Reactive Oxygen Species Assay kit (Beyotime Biotechnology, S0033S). Briefly, RAW264.7 cells (5 × 104) were seeded in confocal Petri dishes (NEST) overnight. Then, the adherent cells were cultured under conditions with various treatments for the indicated times. Subsequently, the cells were stained with ER-Tracker (the detailed experimental procedure is described in step 2.9) and washed with PBS. Then, 2′,7′-dichlorofluorescein diacetate, which was added directly to serum-free medium, was diluted to a final concentration of 10 µM and incubated with cells for 30 min at 37 °C in a humidified incubator containing 5% CO2. 2′,7′‐dichlorofluorescein diacetate diffuses into cells and is deacetylated by cellular esterases to nonfluorescent (DCFH), which can be oxidized by ROS to produce highly fluorescent 2′,7′-dichlorofluorescein. The green fluorescence intensity is proportional to the levels of ROS within a cell. The cells were then washed three times with PBS, and the fluorescence intensity was observed using a laser scanning confocal microscope (Leica).
2.14. Measurement of mitochondrial ROS
The levels of mitochondrial ROS were measured by staining cells with MitoSOX™ Red Mitochondrial Superoxide Indicator (Thermo Fisher Scientific, M36008). Briefly, RAW264.7 cells were seeded at a density of 3 × 103 cells/well on 96-well plates and allowed to attach overnight. Then, the cells were cultured with various treatments for the indicated times. Subsequently, the cells were incubated with MitoSOX at a final concentration of 5 µM for 15 min at 37 °C in a humidified incubator containing 5% CO2. The red fluorescence intensity is proportional to the levels of mitochondrial ROS within the cell. Then, the cells were washed three times with PBS, and the fluorescence intensity was immediately measured with a Varioskan Flash Spectral Scanning Multimode Reader (Thermo Fisher Scientific).
2.15. Statistical analysis
The data are expressed as the mean ± SD of three independent experiments. The difference in means between 2 groups was compared using Student’s t-test. The data for multiple groups were analyzed by one-way analysis of variance with subsequent post hoc multiple comparisons by Dunnett's test. Statistical analyses were performed with the use of GraphPad Prism 5.00 (GraphPad Software, San Diego, CA, USA). Differences with P values < 0.05 were considered statistically significant.