Animals
The animals evaluated in this study were 30 calves divided into two groups. The sepsis group was composed of 20 newborn calves (0-10 days old) which met neonatal sepsis criteria but did not receive any treatment, referred to the clinics of the Department of Internal Medicine, Faculty of Veterinary Medicine, Kafkas University within 24 hours after clinical findings were detected. A control group consisting of 10 healthy calves (0-10 days old) housed in the closed barn system in the University of Veterinary Medicine Education, Research, and Application Farm were used for comparison.
Procedures
Agent Detection from Feces
A rapid test kit (BoviD-5 Ag Test Kit®, Bionote Inc., Korea) was used to detect etiological factors in the feces of calves with neonatal sepsis. Only samples with positive E. coli confirmed by feces rapid test kit results were included in the study. Mixed samples were not included. Positive feces samples were sent to Kafkas University Veterinary Faculty Microbiology Laboratory for confirmation.
Obtaining and Measuring Blood Samples
Blood was collected in gel-containing vacuum tubes (BD Vacutainer®, BD, UK) for biochemical measurements and K2EDTA-containing tubes for hematological measurements (BD Vacutainer®, BD, UK). Total leukocyte count (WBC, x103/µL) and other hematological parameters were determined using a complete blood count device (VG-MS4e®, MELET SCHLOESING Labs., Osny, France) within 30 minutes of sample collection. For analysis requiring sera, after approximately 1 hour at room temperature, blood samples were centrifuged for 10 min at 3000 rpm (Hettich Rotina 380R®, Hettich, Germany) and stored at -20°C until measured. Alanine aminotransferase (ALT), aspartate aminotransferase (AST), gamma-glutamyl transferase (GGT), alkaline phosphatase (ALP), lactate dehydrogenase (LDH), total protein (TP), cholesterol, triglycerides, glucose, creatinine, urea, and creatine kinase (CK) were assessed using a fully automated biochemistry device (Mindray BS120®, Mindray Medical Technology Istanbul, Turkey). Albumin was measured colorimetrically (Epoch®, Biotek, USA) with the methods reported for Hp by Skinner et al. (1991) and Cp by Colombo and Richterich (1964). Cattle P-3, long (PTX3®, Cat: ELK8840, ELK Biotechnology, Wuhan, China) and cattle ET-1 (EDN-1®, Cat: ELK8839, ELK Biotechnology, Wuhan, China) were measured colorimetrically with ELISA kits. Serum measurements of MDA were performed according to Yoshioka et al. (1979) and GSH according to Beutler et al. (1963). The obtained data were processed using a spectrophotometric microplate reader (Spectramax Plus®, Marshall Scientific, Product Code: MD-SMP, NH, USA).
Polymerase Chain Reaction Procedure
Polymerase chain reaction (PCR) was performed to confirm the E. coli K99 strain detected in the feces samples using the rapid test kit. For PCR, 1 g of feces was diluted with 3 ml of phosphate-buffered saline (PBS), from which 1 mL was taken and added to 9 mL of buffered peptone water and incubated at 37°C for 18 hours. At the end of the incubation, 1 mL of the culture was centrifuged at 8000 rpm for 10 minutes. The supernatant was removed, and the pellet was washed 3 times with PBS. At the end of washing, DNA extraction was performed by adding 100 µL of nuclease-free water and boiling the pellet at 99ºC for 10 minutes (Franck et al. 1998). The primer pair in Table 1 was used to determine the K99 gene region of the obtained DNA. For the 50 µL PCR mix, 5 µL of 10x PCR buffer (Thermo Fisher EP0402®, Thermo Fisher Scientific, USA), 1.5mM MgCl2 (Thermo Fisher EP0402®, Thermo Fisher Scientific, USA), 1mM dNTP (Ampliqon A502004®, 40mM mix, Ampliqon A/S, Denmark), 0.5 µM from each primer sequence (Sentebiolab®, Turkey), 1.25 U Taq polymerase (Thermo Fisher EP0402®, 5U/µl, Thermo Fisher Scientific, USA), and 5 µL of the obtained bacterial DNA were added to nuclease-free water. Amplification of the prepared mixture consisted of 25 cycles of denaturation at 94⁰C for 30 seconds, bonding at 50⁰C for 45 seconds, elongation at 70⁰C for 90 seconds, with 3 seconds per cycle added. The final bonding was conducted at 70⁰C for 10 minutes (Franck et al. 1998). The K99 strain found in the collection of the laboratory of the Microbiology Department of the Faculty of Veterinary Medicine of Kafkas University was used as a positive control. The primer pair used was per Roosendaal et al. (1984) (Table 1).
Table 1 Study primer pair
Virulence factor
|
Primary Sequence 5’- 3’
|
Reference
|
Product size
|
K99 (F)
|
TATTATCTTAGGTGGTATGG
|
(Roosendaal et al. 1984)
|
314
|
K99 (R)
|
GGTATCCTTTAGCAGCAGTATTTC
|
SIRS and Sepsis Evaluation
There are specific criteria when determining sepsis and SIRS. The presence of at least two of the following criteria is considered SIRS: Hypothermia or hyperthermia, tachycardia, tachypnea, increased arterial partial carbon dioxide pressure, leukopenia or leukocytosis, and band neutrophil formation with a 10% history. If infection accompanies SIRS, it is considered sepsis (Fecteau et al. 2009; Sen and Constable 2013; Yıldız et al. 2018; Beydilli and Gökçe 2019; Akyüz and Gökçe 2021). Calves with symptoms of depression, diarrhea, low/lack of sucking reflex, dehydration, and constant urge to lie down were examined and evaluated per sepsis criteria. The SIRS criteria for neonatal calves were: body temperature >39.5°C or <37°C, pulse rate per minute <100 or >160, respiratory rate per minute >45, leukocyte count >12×103/μL or <4×103/μL (Fecteau et al. 1997, 2009; Yıldız et al. 2018; Akyüz and Gökce 2021). Calves having at least two of the specified criteria assessed as SIRS and with the presence of infection evaluated to have sepsis were included in the study.
Treatment
Calves with sepsis were kept under observation during treatment in separate compartments. Fluid therapy was provided to these animals according to the severity of dehydration. For this purpose, the calves were intravenously administered 0.9% NaCl (PVC®, 1000 mL Eczacıbaşı Baxter, Istanbul, Turkey), 1.3% NaHCO3 (Bikarvil®, Vilsan, Ankara, Turkey), and 5% dextrose (Polifleks®, Polifarma, Tekirdağ, Turkey). For infection control, they were intramuscularly administered enrofloxacin (Baytril %10®, Bayer, Germany) 2.5-5 mg/kg for 7 days. They were orally administered antipyretic neomycin sulfate and bismuth subcarbonate-containing powder (Cesamolin®, Topkim, Turkey) 10-20 mg/kg for 3 days. For vitamin supplementation, the calves were parenterally administered vitamin B complex (Berovit B12®, Ceva, Australia) in a practical dose of 8-10 mL/calf for 7 days, vitamin C (Maxivit-C®, Bavette, Turkey) 4-6 mg/kg for 7 days, and vitamin ADE in a single subcutaneous dose of 1 mL/50 kg (Ademin®, Ceva, Australia). For mineral supplementation, they were subcutaneously administered a solution of Ca, P, and Mg (Kalsimin®, Vilsan, Germany) at a single dose of 10 mL/50 kg. The calves were also given a single 4-6 mg/kg dose of nonsteroidal anti-inflammatory solution (Bavet Meloxicam®, Bavet, Turkey).
Statistical analysis
The normal distribution of the data of the sepsis group before and after treatment and the control group were evaluated using visual methods (histogram graph and Q-Q graph) and the Shapiro-Wilk test. One-way analysis of variance (ANOVA) was used to compare normally distributed groups. After evaluating the homogeneity of variances with Levene’s test, a Tukey HSD test was applied for post hoc comparison. Pearson correlation coefficients were calculated to define the correlation between variables. The data obtained in the study were reported as mean ± standard error (SEM). All analyses were performed with the SPSS® software program (SPSS Statistics 26.0, Chicago, IL, USA). Differences obtained in group comparisons were considered significant at P<0.05.