Mouse breeding and genotyping
All mice were of the species Mus musculus (C57BL/6). Ecsit Floxed conditional knockout mice were generated by CRISPR/Cas9 based approach. Briefly, two sgRNAs were designed by CRISPR design tool (http://crispr.mit.edu) to target either a region upstream or downstream of the exon 4, and then were screened for on-target activity using a Universal CRISPR Activity Assay (UCATM, Biocytogen Inc, Beijing, China). To minimize random integrations, we employ a circular donor vector. The gene targeting vector containing 5’ homologous arm, target fragment (exon4), 3’ homologous arm was used as a template to repair the DSBs generated by Cas9/sgRNA. The two loxp sites were precisely inserted in both sides of target fragment of the Ecsit gene. T7 promoter sequence was added to the Cas9 or sgRNA template by PCR amplification in vitro. Cas9 mRNA, targeting vector and sgRNAs were co-injected into the cytoplasm of one-cell stage fertilized C57BL/6 eggs. The injected zygotes were transferred into oviducts of Kunming pseudopregnant females to generate F0 mice. F0 mice with expected genotype confirmed by tail genomic DNA PCR and sequencing were mated with C57BL/6 mice to establish germline-transmitted F1 heterozygous mice. F1 heterozygous mice were genotyped by tail genomic PCR, southern blotting and DNA sequencing. The Ecsit knockin floxed mice were generated with CRISPR/Cas-mediated genome engineering by Cyagen Biosciences (Guangzhou, China) Inc. In brief, the gRNA to mouse ROSA26 gene, the donor vector containing "CAG promoter-loxP-3*SV40 pA-loxPKozak-Mouse Ecsit CDS-3xFLAG-rBG pA" cassette, and Cas9 mRNA were co-injected into fertilized mouse eggs to generate targeted conditional knockin offspring. F0 founder animals were identified by PCR followed by sequence analysis, which were bred to wildtype mice to test germline transmission and F1 animal generation. Ecsit -floxed mice were crossed with Villin-Cre mice (Vlliin-Cre; the Jackson laboratory) to generate IEC-conditional Ecsit knockout mice (Ecsit fl/fl Villin-Cre). Ecsit -floxed mice were also crossed with Villin-Cre ERT2 (Kindly provided by Dr. Sylvie Robine and Dr. Yeguang Chen) or Lgr5-Cre ERT2 (Kindly provided by Dr. Jun Qin), and then i.p injected with 3 mg tamoxifen (T5648; Sigma-Aldrich) dissolved in 300 ml corn oil (C8267; Sigma-Aldrich) for five consecutive days to induce the expression of Cre recombinase to achieve conditional deletion of Ecsit in the intestinal epithelium (Ecsit fl/fl Villin-Cre ERT2, termed Ecsit cKO ) or in Lgr5+ stem cell (Ecsit fl/fl Lgr5-CreERT2-GFP) respectively at a specific time (6-8week). The mice were euthanized 17 days after the first injection for phenotype analysis. The Ecsit knockin floxed mice were crossed with Ecsit fl/fl Villin-Cre ERT2 to rescue the expression of Ecsit in ECSIT deficient mice. For spontaneous bowel cancer model, we constructed Ecsit fl/fl Vil1in-Cre-ERT2 Apc min/+ mice (Apc min/+ mice was kindly provided by Dr. Jun Qin), and the Ecsit fl/fl Apc min/+ mice was regarded as control. Mice were gavaged with tamoxifen (4mg) every other day twice to conditionally knock down ECSIT in intestinal epithelium and euthanized the mice 2 months after the last administration. Mice were housed in conventional cages in an animal room at constant temperature (19-23 °C) and humidity (55 ± 10%) under a 12-h light–dark cycle and were allowed access to standard diet and water ad libitum. All animal experiments were conducted in accordance with the procedure approved by the Ethical Review Committee for Laboratory Animal Welfare of Nanjing Medical University.
Isolation of whole epithelium
The method for isolation of whole epithelium cell for single cell RNA-seq was based on a previously published method[19]. Briefly, the mouse small intestines or colons were flushed with ice-cold PBS, cut longitudinally into roughly 2 mm-long pieces, rinsed with ice-cold PBS and incubated in 20 mM EDTA at 4 °C for 90 min with continuous shaking. The fraction was washed twice in PBS, centrifuged at 300g for 3 min. For single cell RNA-seq, cells were dissociated with 1x Trypsin-EDTA Solution (Sigma) for 10 min at 37 °C. The single-cell suspension was then passed through a 70-mm filter. After washing with PBS containing 0.04% BSA, the cell pellets were re-suspended in PBS containing 0.04% BSA and re-filtered through a 35mm cell strainer. Dissociated single cells were then stained with AO/PI for viability assessment using Countstar Fluorescence Cell Analyzer. The single-cell suspension was further enriched with a MACS dead cell removal kit (Miltenyi Biotec).
Single-cell RNA Sequencing
The scRNA-Seq libraries were generated using the 10X Genomics Chromium Controller Instrument and Chromium Single Cell 3’ V3 Reagent Kits (10X Genomics, Pleasanton, CA). Briefly, cells were concentrated to 1000 cells/ml and approximately 8,000 cells were loaded into each channel to generate single-cell Gel Bead-In-Emulsions (GEMs), which results in expected mRNA barcoding of 6,500 single-cells for each sample. After the RT step, GEMs were broken and barcoded-cDNA was purified and amplified. The amplified barcoded cDNA was fragmented, A-tailed, ligated with adaptors and index PCR amplified. The final libraries were quantified using the Qubit High Sensitivity DNA assay (Thermo Fisher Scientific) and the size distribution of the libraries were determined using a High Sensitivity DNA chip on a Bioanalyzer 2200 (Agilent). All libraries were sequenced by illumina sequencer (Illumina, San Diego, CA) on a 150 bp paired-end run.
Analysis of scRNA-seq data
scRNA-seq data analysis was performed by NovelBio Bio-Pharm Technology Co.,Ltd with NovelBrain Cloud Analysis Platform(www.novelbrain.com). We applied fastp with default parameter filtering the adaptor sequence and removed the low-quality reads to achieve the clean data. Then the feature-barcode matrices were obtained by aligning reads to the mouse genome (mm10 Ensemble: version 92) using CellRanger v3.1.0. We applied the down sample analysis among samples sequenced according to the mapped barcoded reads per cell of each sample and finally achieved the aggregated matrix. Cells contained over 800 expressed genes and mitochondria UMI rate below 40% passed the cell quality filtering and mitochondria genes were removed in the expression table. Seurat package (version: 3.1, https://satijalab.org/seurat/) was used for cell normalization and regression based on the expression table according to the UMI counts of each sample and percent of mitochondria rate to obtain the scaled data. PCA was constructed based on the scaled data with top 2000 high variable genes and top 10 principals were used for tSNE construction. Utilizing graph-based cluster method, we acquired the unsupervised cell cluster result based the PCA top 10 principal and we calculated the marker genes by FindAllMarkers function with wilcox rank sum test algorithm under following criteria:1. ln fold change > 0.25; 2. P value<0.05; 3. min.pct>0.1. In order to identify the cell type detailed, the clusters of same cell type were selected for re-tSNE analysis, graph-based clustering and marker analysis. The Gene ontology analysis with GO database (download from NCBI, Uniprot and AmiGO) and the pathway analysis with KEGG, Biocarta and hallmark database were applied for functional annotation. Significance P-Value was defined by the Fisher’s exact test. We applied the ssGSEA function of GSVA package based on several selected gene sets to get score of each group, then violin plot was used to demonstrate the functional difference between groups, the gene signature used can be found in Table S1. Raw data files and have been uploaded to Gene Expression Omnibus public database (GSE198550).
Intestinal organoid cultures and imaging
The isolation of intestinal crypts and the culture of organoid was on the basis of previously published methods [22]. In brief, the section of the initial part of the intestine was opened lengthwise, cleaned with cold PBS. After removal of villi by scraping with a cold glass slide, the intestine was sliced into small fragments roughly 2 mm in length. The tissue was then incubated in 2.5 mM EDTA/PBS at 4 °C for 30 min with shaking. Crypts were detached from the tissue through vigorous shaking and filtered through a 70 mm filter. Crypts were embedded onto Matrigel (Corning) at 50 ml per well in 24-well plates. The culture medium was Advanced Dulbecco’s modified Eagle medium (DMEM)/F12 (Gibco), containing GlutaMAX (2 mM, Solarbio), HEPES (10 mM, Solarbio), NAC (1 mM, bryotime) and penicillin–streptomycin (100 U/ml Gibco). The medium was supplemented with B27 (1:50, Gibco), Noggin (100 ng/ml, Peprotech), EGF (50 ng/ml, Peprotech) and R-spondin-1 (500 ng/ml, Peprotech). For ApcMin/+ primary mouse tumor organoids [33], the medium was Advanced DMEM/F12 supplemented with mouse EGF and B27 alone based on the previously method. Knockout induction in the crypt cultures was achieved by incubation with 300 nM 4-hydroxytamoxifen (4OHT; Sigma-Aldrich) for 72 h. Organoids were treated with 2.5 mM 4EGI-1 (MCE, HY-19831), 2 mM Sanguinarine chloride (MCE, HY-N0052A), 2.5 mM Verteporfin (CSNpharm, CSN12195), 2 mM dimethyl a-ketoglutarate (DM-aKG, Sigma, 349631) or 10 mM dimethyl succinate (DM-Suc, Sigma, W239607) respectively in indicated experiment. Fixed sample preparation and imaging was based on the previously method [11]. Plate was centrifuged at 3000 rpm for 10 min in a pre-cooled centrifuge at 10 °C prior to fixation. Organoids were fixed in 4% PFA in PBS for 45 min at room temperature, permeabilized with 0.5% Triton X-100 for 1 h (for YAP immunofluorescent staining of intestinal organoid) or unpermeabilized (for other staining), blocked with 5% goat serum and 0.1% Triton X-100 in PBS for 1 h. Organoids were incubated with primary antibodies diluted in blocking buffer at 4°C for overnight, primary antibodies were anti-LYZ1 (Abcam, 1:250), rabbit anti-YAP (CST, 1:400), rabbit anti-eIF4A1 (Bioworld, 1:500) and rabbit anti-eIF4G2 (CST, 1:500), and then were incubated with the secondary antibodies for 2 h at room temperature. Cell nucleus were stained with 20 mg/ml DAPI (4',6-Diamidino-2-Phenylindole, Invitrogen) in PBS for 10 min. Images were taken using Zeiss LSM 800 confocal microscope, and processed using ImageJ and AdobePhotoshopCS6 software. For immunofluorescent quantification, the indicated fluorescence intensity of organoid was normalized to the intensity of DAPI.
RNA-seq
RNA isolation, library construction, and sequencing were performed on a MGI2000 (Beijing Genomic Institution, BGI). Clean reads were mapped to the mouse genome (GRCm38.p6) by HISAT2. For gene expression analysis, the matched reads were calculated and then normalized to FPKM. Fold changes were calculated for all possible comparisons and a 1.2-fold cutoff was used to select genes with expression changes. GO pathway enrichment analysis was performed by applying the online tool of DAVID Bioinformatics Resources 6.8 (http://david.ncifcrf.gov), using significantly differentially expressed genes (fold change>1.2, p value<0.05) as target genes. GSEA analysis was performed on software GSEA v3.0. The sequencing data have been deposited in the NCBI Sequence Read Archive (SRA) database under the NCBI Bioproject PRJNA795031.
Isolation of lamina propria cells and flow cytometry
Small intestine and colon tissues were incubated at 37°C in PBS containing 2% FBS and 5 mM EDTA for 25 min. The remaining tissue was cut into small pieces and digested in PBS containing 2% FBS, Collagenase IV (0.5 mg/ml; Thermo) and DNase I (10 U/ml; Sigma-Aldrich) and then incubated at 37°C for 45min. Single cell suspensions were stained with anti-CD45-Alexa Flour 700 (eBioscience, 30-F11, 56-0451-82, 1:400), anti-CD4-APC-Cy7 (Biolegend, GK1.5, 100414, 1:400), anti-CD8a- PE (eBioscience, 53-6.7, 12-0081-83, 1:400), anti-NK1.1-PE-Cy7 (eBioscience, PK136, 25-5941-82, 1:400), anti-CD19-APC (eBioscience, 1D3, 17-0193-80, 1:400), anti-CD11b-FITC (Biolegend, 101206, M1/70, 1:400), anti-CD11c-PE (eBioscience, N418, 12-0114-82, 1:400) and FVD eFlour 506 (eBioscience,1:1000) for FACS analysis (Thermo). All flow cytometry was performed on an Attune NxT Flow Cytometer (Thermo Fisher Scientific), and data were analyzed by FlowJo 10 software.
Histology, immunofluorescence and immunohistochemistry
For histology, the samples were washed, fixed in 4% buffered formaldehyde, and embedded in paraffin. Tissue sections were stained with H&E. Images were acquired with a Nikon 50i inverted microscope. For immunofluorescence (IF) and immunohistochemistry (IHC), freshly isolated tissue was fixed in 4% paraformaldehyde, dehydrated and mounted in paraffin using standard protocols. Material for frozen sections was processed and embedded in OCT (Tissue-Tek; Sakura Finetek) according to standard protocols. Standard immunohistochemical protocols were performed with the following antibodies: rabbit anti-ECSIT (Nuvus, 1:400), rabbit anti-YAP (CST, 1:400), rabbit anti-MUC2 (Abcam, 1:100), rabbit anti-ChgA (Nuvus, 1:300), rabbit anti-DCLK (Abcam, 1:800), rabbit anti-LYZ1 (Abcam, 1:250), rabbit anti-SCA1-Alexa Fluor 647 (Biolegend, 1:400), rabbit anti-CCND2 (SAB, 1:200), rabbit anti-eIF4A1 (Bioworld, 1:100), rabbit anti-eIF4G2 (CST, 1:400), mouse anti-PCNA (Santa Cruz, 1:300), rabbit anti-OLFM4 (CST, 1:400), rabbit anti-SOX9 (Sigma, 1:300) and rabbit anti-GFP tag (Proteintech, 1:150). Secondary antibodies were anti-rabbit goat antibodies conjugated with Alexa (A488 or A555) from ThermoFisher Scientific. For IHC staining, secondary antibodies were horseradish peroxidase (HRP) polymer-conjugated goat anti-mouse or goat anti-rabbit (Thermo). Diaminobenzidine (DAB) chromogen (Boster) was used for detection and haematoxylin was used as a counterstain. Images for HE and IHC were acquired on Nikon DS-Ri2 with NIS-Elements F 4.60 software. Images for Immunofluorescence were acquired on Zeiss LSM 800 confocal microscope with ZEN software.
Tissue microarrays (TMA) and IHC staining
A tissue microarray (TMA) containing 83 paired CRC tissues (Cat No. COC1602) was purchased from the Shanghai Superbiotek Pharmaceutical Technology (Shanghai, China). Antibodies against ECSIT were used for immunohistochemistry staining. Data analysis was performed blindly.
RNA extraction and real time quantitative PCR (RT–qPCR)
Total RNA was extracted using TRIzol reagent (Life) and subjected to complementary DNA synthesis. Reverse transcription products of different samples were amplified by StepOnePlus (Applied Biosystems) using AceQ qPCR SYBR Green Master Mix (Vazyme) according to the manufacturer’s instructions. Data were analyzed according the ΔCt method. All results were normalized to Hprt quantified in parallel amplification reactions. All primers were purchased from Sangon Biotech. Primers used were Hprt-F: GTCCCAGCGTCGTGATTAGC, Hprt-R: TGATGGCCTCCCATCTCCT, Yap-F: TGAGATCCCTGATGATGTACCAC, Yap-R: TGTTGTTGTCTGATCGTTGTGAT, Ly6a-F: GAAAGAGCTCAGGGACTGGAGTGTT, Ly6a-R: TTAGGAGGGCAGATGGGTAAGCAA, Ccnd2-F: GTCCCGACTCCTAAGACCCAT, Ccnd2-R: CAGGCTTTGAGACAATCCACAT.
Immunoblotting
Homogenates of epithelium were lysed in RIPA solution (Yeasen) supplemented with a protease inhibitor cocktail (Sigma-Aldrich) at 4°C for 1h. The protein from epithelial mitochondria was extracted by using the Mitochondrial Isolation Kit (Yeasen) according to the manufacturer’s instructions. Samples were clarified, denatured with SDS buffer, and boiled for 10 min. Proteins were separated by SDS–polyacrylamide gel electrophoresis and transferred onto nitrocellulose membranes. The membranes were immunoblotted with primary antibodies: rabbit anti-ECSIT (Nuvus, 1:1000), rabbit anti-YAP (CST, 1:1000), rabbitanti-SCA1 (SAB, 1:1000), rabbit anti-CCND2 (SAB, 1:1000), rabbit anti-ATP5A (Bioworld, 1:1000), rabbit anti-UQCRC2 (Bioworld, 1:1000), rabbit anti-SDHB (Bioworld, 1:1000), rabbit anti-MTCO1 (Abcam, 1:1000), or mouse anti-NDUFS8 (Santa Cruz, 1:1000) and proteins detected with appropriate secondary anti-rabbit or anti-mouse antibody conjugated to fluorescence. Immunoreactivity was visualized by the Odyssey Imaging System (LI-COR Biosciences).
Metabolomics
Whole epithelium from colon and small intestine were freeze dried for 12 h and weighed. The freeze-dried tissues were thawed out on the ice, extracted with 800 ml of 80% methanol, vortexed for 1min. Then the samples were ultrasonicated for 30 min at 4°C, and let stand for 1 hour at -40°C, vortexed for 30 s, and let stand for 0.5 h at 4°C, centrifuged at 12000 rpm and 4 °C for 15 min. All the supernatants were taken in the centrifuge tube and concentrate to remove organic reagents and water and then reconstituted in 100 ml 80% methanol, vortex 1 min, centrifuged for 15 min and the supernatant was transferred to vial for Liquid chromatography-tandem mass spectrometry (LC-MS/MS)-based widely targeted metabolomics in the Shanghai Sensichip Infotech Co. (Shanghai, China). The final data were imported into SIMCA-P software for multivariate statistical analysis. PCA were carried out to explore the differences of the metabolites between the groups. Metabolite abundance between samples can be found in Table S2. Differential metabolite data were used for pathway enrichment analysis on the MetaboAnalyst 3.0 (http://www.metaboanalyst.ca). P-values < 0.05 were considered statistically significant.
Proteomics
Whole epithelium from colon and small intestine were incubated in lysis buffer (1% DOC, 10 mM TCEP, 40 mM CAA and 100 mM Tris-HCl pH 8.8). After heating at 95 ºC for 5 min, place them on ice for ultrasonic disintegration (3s on, 3s off, 30% energy). Centrifuge the mixture at 16,000 g for 10 min at 4°C and save the supernatant as a whole tissue extract (WTE). The protein concentration was quantified by Thermo Nanodrop One (Thermo Fisher, USA). Protein (100 mg) was cleaved at the C-terminus of Arg or Lys residues overnight at 37°C with 1:50 trypsin (Promega, USA). The next day, the digestion was stopped by adding formic acid at a final concentration of 1%. LC-MS/MS analysis was performed on an Orbitrap Fusion Tribrid mass spectrometer (Thermo Fisher Scientific) coupled on-line to a nanoflow LC system (EASY-nLC 1200, Thermo Fisher Scientific) in National Center for Protein Sciences (Beijing, China). GO and KEGG pathway enrichment analysis was performed by applying the online tool of DAVID Bioinformatics Resources 6.8 (http://david.ncifcrf.gov). GSEA analysis was performed on software GSEA v3.0. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium (http://proteomecentral.proteomexchange.org) via the iProX partner repository with the dataset identifier PXD033272.
TET activity assay
Intestinal epithelium nuclear were extracted, and the 5mC Hydroxylase TET Activity/Inhibition Assay Kit (Colorimetric) (Epigentek) was used to assay TET enzymatic activity according to manufacturer’s instructions.
Sucrose gradient polysome fractionation
Intestinal epithelium lysates were prepared in a buffer containing 100 mM KCl, 0.1% Triton X-100, 50 mM HEPES, 2 mM MgCl2, 10% glycerol, 1 mM DTT, 20 U/ml Protector RNase Inhibitor (Vazyme) and 1 × EDTA free protease inhibitor cocktail (Roche), and kept on ice for 15 min before centrifugation at 10,000 g for 10 min. The supernatant was carefully loaded on 20 to 50%
w/v linear density sucrose gradient (Gradient Master, Biocomp, Fredericton, NB, Canada) and centrifuged at 38,000 rpm, for 2.5 h (Beckman Coulter Optima L-100XP Ultracentrifuge, Brea, CA, USA). The polysome fractions were collected using a piston gradient fractionator (Biocomp). In addition, the total RNA in each tube was isolated and the RNA expression of Yap in each fraction was determined by real-time qPCR. Primers used were Yap-F: TTGGAGGCGCTCTTCAATG, Yap-R: TCCTGCCATGTTGTTGTCTGA, Gapdh-F: GAAGGTCGGTGTGAACGGATTTG, Gapdh-R: ATTTGATGTTAGTGGGGTCTCGCTC.
Methylated DNA immunoprecipitation (MeDIP)
MeDIP analysis was performed according to the manufacturer's instructions (Bersinbio). Total genomic DNA was sonicated to yield DNA fragments between 300 bp and 700 bp in length. One microgram of fragmented DNA was heat denatured to produce single-stranded DNA. Immunoprecipitation was performed for overnight at 4°C using 5 mg anti-5mC antibody (Abcam), with 5 mg of normal rabbit IgG as the negative control. Real-time qPCR was performed to evaluate the DNA methylation of target gene. Primers used were Eif4a1-F: GGCTGTGCTTTATCTCAGGTCTTC, Eif4a1-R: TCATATTTACTGCCATCTGCTCCC, Eif4g2-F: CAGCCTCATGCTTGCATAGAAGAACC, Eif4g2-R: AAAGCTCCCAGACGCTAAACCG.
RNA Immunoprecipitation (RIP)
RIP analysis was performed according to the manufacturer's instructions (Bersinbio). Immunoprecipitation was performed for overnight at 4°C using eIF4A1 (Bioworld, 1:50) or eIF4G2 (CST, 1:50), with 5 μg of normal rabbit IgG as the negative control. The RNA was subjected to cDNA synthesis and RT-qPCR was performed.
Statistical analysis
Information about statistical details and methods is indicated in the figure legends. Statistical analysis was performed using GraphPad Prism 8.0 or 9.0.