First DNA barcode efficiency assessment for an important ingredient in the Amazonian ayahuasca tea: mariri/jagube, Banisteriopsis (Malpighiaceae)

doi:10.21203/rs.3.rs-1424893/v1

Download PDF

Research Article

First DNA barcode efficiency assessment for an important ingredient in the Amazonian ayahuasca tea: mariri/jagube, Banisteriopsis (Malpighiaceae)

https://doi.org/10.21203/rs.3.rs-1424893/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Mariri or jagube (Banisteriopsis spp.) is a vine of the Malpighiaceae family naturally found in the Amazon rainforest in Brazil. It is also an important ingredient of ayahuasca tea used by some traditional, indigenous people and religious groups of Amazonian origin. This study aimed to evaluate the efficiency of six markers such as DNA barcode to access genetic diversity and use them in the identification of either ethnovarieties or species of Banisteriopsis spp. used in the preparation of ayahuasca in the Amazon. The efficiency of three plastid genes (matK, ndhF, and rcbL) and three nuclear markers (MP3 and yage5 isolated in the present study and ITS - Internal Transcribed Spacer) were tested. For these six markers, a total of 4,792 base pairs were sequenced. The plastid markers identified that all the samples analyzed belong to the genus Banisteriopsis; however, they presented the lowest indices of genetic diversity and were not efficient for use in the identification of ethnovarieties. Nuclear DNA markers showed the highest levels of genetic diversity. The ITS showed the highest values of genetic distances between the identified lineages. This study demonstrates that the use of ITS for DNA barcoding was more efficient since the identified lineages showed correspondence with the ethnovarieties of Banisteriopsis spp. used in the preparation of ayahuasca. We encourage new integrative studies like this one, which combines modern approaches and traditional knowledge, to contribute to the maintenance of traditional knowledge as well as the conservation of species.

Ethnobotany

Traditional knowledge

Banisteriopsis caapi

Conservation.

Banisteriopsis C. B. Rob. (Malpighiaceae) is a Neotropical genus with 60 accepted species that are distributed from Mexico to Argentina (The Plant List, 2019). Species of this genus have biologically active metabolites that present important pharmacological activities (Dos Santos and Hallak 2019). Among these species is the vine Banisteriopsis caapi (Spruce ex Griseb.) C. V. Morton, which is found in the Amazon Rainforest and which is one of the main ingredients of an entheogenic tea known as ayahuasca.

This tea has been used for centuries by indigenous groups of the Amazon in Brazil, Peru, Colombia, and Ecuador for ritual, religious and therapeutic purposes (Schultes et al. 1992; Ogalde et al. 2009). The popularly known formula of ayahuasca is the decoction of the macerated vine of B. caapi (mariri/jagube) with leaves from Psychotria viridis Ruiz & Pav (chacrona/rainha). In its composition, the vine B. caapi contains alkaloids that belong to the group of β-carbolines, and the species P. viridis has in its composition N, N-dimethyltryptamine (DMT), which is considered to be the main entheogenic agent of the drink (Callaway et al. 2005).

Ayahuasca is also used by non-indigenous populations of these countries, such as syncretic religious organizations that originate in the Northern Region of Brazil, the main ones being Santo Daime and the Centro Espírita Beneficente União do Vegetal (CEBUDV), in which ayahuasca is called “Daime” and “Hoasca”, respectively. The CEBUDV is present in all Brazilian states and ten countries: the United States, Canada, Peru, Portugal, Spain, the United Kingdom, Switzerland, Italy, the Netherlands, and Australia (CEBUDV, 2022a). Although the CEBUDV is present in the main capitals of Brazil, many of its members in the Amazon region are descendants of traditional and indigenous peoples and were already familiar with ayahuasca before entering the religion, a fact that makes the holders of traditional knowledge.

Although Banisteriopsis caapi is the species traditionally attributed to the ayahuasca drink, there are reports that B. muricata and other species of the genus are also used for the preparation of tea (Gates 1982; Schultes 1984; Schultes et al. 1992). Due to the scarcity of fertile collections and lack of detailed taxonomic studies, these species have not been properly discriminated against and described. We must also consider that the floral morphology found in the genus Banisteriopsis has preserved characters and this hinders the clear identification and classification of the species of the genus (Gates 1982; Langdon 1986).

The indigenous peoples and traditional populations of the Amazon recognize diverse ethnovarieties of the Banisteriopsis spp. vines that are used for the preparation of ayahuasca. Among the Siona indigenous peoples, at least eighteen ethnovarieties have been identified; however, it was only possible to collect reproductive branches from five varieties and they were identified as B. caapi (Langdon 1986). Among the Colombian Tukans of the Vaupés River, six ethnovarieties of the ayahuasca vine are recognized; though, botanical identification has not yet been possible (Schultes et al. 1992).

The CEBUDV recognizes two ethnovarieties of Banisteriopsis spp.: mariri tucunacá and mariri caupuri. On the other hand, some of the people at CEBUDV identify more ethnovarieties (Cattanio et al. 2011), for example, pajézinho, caupuri without nodes, tucunacá with nodes, mariri nativo, and amarelinho, among others. Santo Daime recognizes 11 varieties (Monteles 2020), though this can reach up to 20 varieties (personal information from R. Monteles), and at least 30 ethnovarieties are recognized by the natives throughout the western Amazon (Schultes 1986).

Schultes (1986) described a botanical enigma, which concerns the “mysterious” ability of the Amazonian natives to distinguish between varieties of plants, which he could not distinguish at the botanical level, especially those used to make ayahuasca. The author reports that the members of different tribes, who live significant distances from each other, identify the varieties of the vine of ayahuasca with incredible consistency. Schultes (1986) noted that it was “botanically impossible” to discern morphological differences to separate these varieties from each other and lamented the fact that so little research has been dedicated to “this fascinating aspect of ethnobotany”. This is a situation that remains to the present day.

Historically, ethnobotanists have documented, described, and explained the complex relationships between crops and the usefulness of plants (Newmaster and Ragupathy 2010). As such, ethnobotany identifies plants that may have agricultural, industrial or pharmacological value (Schultes 1979). In other situations, ethnobotanical knowledge can be used as a base to aggregate indigenous and traditional knowledge within their own scientific and cultural structures. This approach is based on the concept of an assembly of knowledge on biodiversity, which includes a union of different ways of identifying and valuing species variation in a new approach that seeks to add value to traditional and scientific knowledge (Newmaster and Ragupathy 2010; Hibert et al. 2011).

In this sense, we used the DNA barcode approach to evaluate the efficiency of three plastid markers (matK, rcbL, and ndhF) and three nuclear markers (two of these isolated in the present study and the ITS), and access the genetic diversity of the vines used in the preparation of ayahuasca in the Amazon. We also evaluated the correspondence of the identified genetic lineages with the ethnovarieties known in the traditional context of the CEBUDV and with the DNA sequences (matK, ndhF, and rcbL) of the species of Banisteriopsis spp., which have been identified at the morphological level by Davis and Anderson (2010). The final objective of the study was to present the most efficient markers for future genetic studies for the conservation of the ethnovarieties known by members of the CEBUDV in the Amazon to contribute to the maintenance of traditional knowledge.

DNA sampling and extraction

A total of 20 samples of mariri vines (Banisteriopsis spp.) were obtained. The collections were carried out between the years of 2017 and 2018 in Manaus, Novo Airão, and Presidente Figueiredo, which are three municipalities of the state of Amazonas (Fig. 1). In Manaus, 15 samples were collected in three plantings of three nuclei (Núcleo Mestre Vicente Marques, Núcleo Mestre Angílio and Núcleo Flor do Norte) of the CEBUDV (Table S1). For the collection of these plantings, different morphological variations of the vine stem were prioritized (Fig. 2d and Fig. S1). In Presidente Figueiredo (4 samples) and Novo Airão (1 sample) (Table S1), the collections were carried out in a natural environment and had the support of CEBUDV leaders, who are holders of the traditional knowledge of the vines that are used for the preparation of ayahuasca tea.

For the molecular analysis, the cambium tissue or leaves of vines (Banisteriopsis spp.) were stored in containers containing silica gel and subsequently stored in the freezer. Genomic DNA was extracted from 120 mg of plant material following the CTAB plant tissue extraction protocol (Oliveira et al. 2017).

Development of the genomic library

The DNA genomic library was constructed for Banisteriopsis spp. using a sample (MT1, tucunacá without nodes) cultivated in the Mestre Angílio nucleus (Manaus, AM). The protocol described by Billotte et al. (1999) with modifications (no probes were used for selection of microsatellites) was used, and plasmid DNA from 96 clones was extracted according to Green and Sambrook (2012). For the sequence reactions of the clones, the T7 and SP6 primers were used with the Big Dye terminator V3.1 Kit. Sequencing was performed on a sequencer ABI 3130xl DNA Analyzer (ThermoFisher).

The sequences were edited using The SEQSCAPE v2.7 (Applied Biosystems) program and analyzed in the basic local alignment search tool (BLASTN) (Altschul et al. 1990) in the sequence database of the National Center for Biotechnology Information (NCBI), for verification and confirmation of anonymous DNA regions and protein-coding regions. The design of the primers was carried out with the help of the program PRIMER3 web version 4.0.0 (Koressaar and Remm 2007; Untergasser et al. 2012).

Amplification and sequencing of nuclear and plastid DNA markers

Three markers were amplified for nuclear DNA, which was two nuclear markers resulting from the genomic library that was built in the present study and the internal transcribed spacer (ITS) (Table 1). Three plastid markers were also amplified: maturase K (matK), ribulose-1,5-bisphosphate (rbcL), and dehydrogenase F (ndhF) (Table 1). The total volume of each of the PCRs (polymerase chain reactions) was 17 µL, and contained 2 µL of genomic DNA, 4.7 µL of ultrapure water, 1.5 µL of PCR buffer 10x (Thermo Scientific), 2 µL MgCl₂ 25 mM, 3 µL dNTPs 1 mM, 0.3 µL of Taq 5 U/µL, 1.5 µL BSA (bovine serum albumin) 10x, 1 µL primer 5µM (forward and reverse). For the rbcL, we used the primers rbcL-01F and rbcL-1367r and for the matK were used the primers trnK-2R and matK-400F (Table 1). The amplification were performed in a thermal cycler (Veriti®, ThermoFisher) and followed the cycles given in Table 1. We stained PCR products with nucleic acid dye (Diamond™, Promega) and checked their size and quality in 1% agarose gel. The PCR products were purified using the GFX purification kit (GE Healthcare).

Table 1

Molecular markers and their primers were selected for the genetic characterization of 20 *Banisteropsis* spp. vines, which are used in the preparation of ayahuasca tea.
Molecular Marker	Name of the primer	The sequence of the primers 5'-3'	Thermocycling	Reference
ITS	ITS-5A	CCTTATCATTTAGAGGAAGGAG	94°C 2 min, [35 cycles: 94°C 1 min, 54°C 1 min, 72°C 2 min] 72°C 5 min	(Stanford et al. 2000)
ITS	ITS-4	TCCTCCGCTTATTGATATGC		(White et al. 1990)
MP3	MP3-KinaseF	CCACGCATATAACCGTGAGA	98°C 45 seg, [35 cycles: 98°C 10 seg, 56°C 1 min, 72°C 40 seg] 72°C 10 min	Present study
MP3	MP3-KinaseR	CCGCACACAACTCCATGA		Present study
yage5	yage5-F	CAGAGCCTCTATATGATGTCACC	68°C 1 min, [35 cycles: 93°C 30 seg, 56°C 40 seg, 72°C 1 min] 72°C 8 min	Present study
yage5	yage5-R	CACGACCGATACGGGCTA		Present study
rbcL	rbcL-1F	ATGTCACCACAAACAGAAAC	80°C 30 seg, [35 cycles: 95°C 1 min, 58°C 1 min, 65°C 2 min] 65°C 10 min	(Cameron et al. 2001)
	rbcL-636F	GCGTTGGAGAGATCGTTTCT
	rbcL-724R	TCGCATGTACCTGCAGTAGC
	rbcL-1367R	CTTTCCAAATTTCACAAGCAGCA
matK	trnK-2R	AACTAGTCGGATGGAGTAG	95°C 1 min, [35 cycles: 95°C 1 min, 54°C 1 min, 72°C 2 min] 72°C 10 min	(Cameron et al. 2001)
	matK-400F	CCCTAATTTACGATCAATTCATTCAAT
	matK-842F	GATCCTTTCATACATTATGT
ndhF	ndhF-5.5F	TTAGTRAYAGTYGGTTGTATTCACC	80°C 30 seg, [35 cycles: 95°C 1 min, 58°C 1 min, 65°C 2 min] 65°C 10 min	(Davis et al. 2001)
ndhF	ndhF-10.2R	CCATCRATNACTCGYCYATCAAAAA		(Davis et al. 2001)

Nucleotide sequencing reactions were performed according to Platt et al. (2007) using the BigDye® Terminator V3.1 Cycle Sequencing Kit (Applied Biosystems). For rbcL and matK markers, we also used internal primers for sequencing reactions, in this case, rbcL-636F, rbcL-724R, and matK-400F (Table 1). Nucleotide sequencing was performed in ABI 3130xl DNA Analyzer (ThermoFisher)

Analysis of DNA sequence data

The SEQSCAPE v2.7 (Applied Biosystems) program was used to edit the sequences of nuclear and plastid markers. For the alignment of the sequences, we used the program MAFFT v7.307 (Katoh and Standley 2013). For nuclear markers, sites that had double peaks occurring in the same position on the electropherogram (in both strands) were considered ambiguous sites and treated as missing data.

Genetic diversity indices were estimated for all markers using the DNASP 6.0 program (Rozas et al. 2017). Phylogenetic trees were constructed for all markers using the neighbor-joining (NJ) method using the K2P model in MEGA X (Kumar et al. 2018) and also by the maximum likelihood (ML) method in RAXML v8.2.10 (Stamatakis 2014). The reliability of each node of the NJ and ML analyses was estimated by the bootstrap method with 1000 replicas (Felsenstein 1985). The genetic distances for each marker were estimated and considered the clades and/or genetic lineages identified in the respective phylogenies. Genetic distances were calculated using the Kimura-2-parameters model (Kimura 1980) with bootstrap support with 1000 replications in the MEGA X program (Kumar et al. 2018).

We also performed NJ and ML phylogenetic analyses for the three markers (rbcL, matK, and ndhF) with concatenated sequences, including seven species of Banisteriopsis that have sequences for the same markers, which were also identified morphologically by Davis and Anderson (2010). The sequences of plastid markers (matK, rbcL, and ndhF) generated in the present study were compared with the sequences of 19 species of Banisteriopsis spp. (Davis and Anderson 2010). For these comparisons, BLAST N analyses were used in the NCBI sequence database. The ITS nuclear marker sequences were also subjected to the same analysis.

Genomic Library

From the 96 clones in the DNA genomic library, good quality sequences were obtained for 53 clones that ranged from 570 to 1,004 base pairs (bp) and, of these, 52 were nucleotide sequences of non-redundant clones. In all, 10 pairs of primers were designed, seven amplified for all samples and two (MP3, yage5) presented good quality sequences and were used in the genetic analysis. The clone sequence used for the design of the yage5 marker primers (accession XXX) did not show significant similarity with the NCBI database after analysis in BLAST N. However, the clone sequence used for the design of the MP3 marker primers (accession XXX) presented up to 82.72% identity percentage (45% query cover) with the protein kinase (accession LN713255).

Nuclear markers

The alignments of the three nuclear markers MP3, yage5, and ITS resulted in a length of 425 bp, 566 bp, and 523 bp, respectively, and resulted in a total of 1,514 bp. For these markers, the number of polymorphic sites ranged from 3 (MP3) to 159 (ITS), haplotypic diversity ranged from 0.883 (MP3) to 0.990 (yage5), nucleotide diversity ranged from 0.00073 (MP3) to 0.11670 (ITS), with indels (inserts or deletions) ranging from 1 (MP3) to 6 (ITS). The highest numbers of haplotypes were observed for ITS and yage5, which presented 14 haplotypes each (Table 2).

Table 2

Genetic diversity indices obtained from the nucleotide sequence of six molecular markers for *Banisteriopsis* spp.
Molecular Marker	N	Size (bp)	S	ETA	h	Hd	Pi	I
MP3	19	425	3	3	10	0.883	0.00073	1
yage5	15	566	44	44	14	0.990	0.02819	4
ITS	16	523	159	174	14	0.975	0.11670	6
matK	20	1301	3	3	3	0.637	0.00082	0
ndhF	19	687	3	3	4	0.696	0.00487	0
rbcL	20	1290	1	1	2	0.505	0.00039	0
N = number of samples sequenced, S = polymorphic sites, ETA = total number of mutations, h = number of haplotypes, Hd = haplotypic diversity, Pi = nucleotide diversity, I = indels.

Three clades were identified (A, B, and C) with bootstrap support values > 99 and 7 genetic lineages (I to VII; Fig. 2) based on the topology of the NJ and ML phylogenetic tree using the ITS marker. Clade A is made up of lineage I with a sample of the tucunacá ethnovariety that was collected in a cultivation environment (MA8), and lineage II with 3 samples of the native tucunacá ethnovariety, which was collected in a natural environment (Presidente Figueiredo). These two lineages (I and II) had a genetic distance of 3.83% (Table 3). Clade B is represented by lineages III and IV (Fig. 2). Genetic lineage III has half of the sequences analyzed in the present study and includes only samples of the ethnovariety caupuri with and without nodes, which were collected at the CEBUDV nuclei. Lineage IV is also part of the ethnovariety caupuri with nodes (sample MOAC3) and is a sister lineage to lineage III, which presented a 4.04% genetic distance (Fig. 2 and Table 3). Clade C is represented by the ethnovarieties that are more related to pajezinho, and include three lineages (V, VI, and VII), two of which are native (Presidente Figueiredo and Novo Airão) and one that is cultivated.

Table 3

Genetic distances K2P (in percentage) based on the molecular marker ITS, estimated between the seven genetic lineages of *Banisteriopsis* spp. (*mariri*) which are used in the preparation of ayahuasca in the Amazon by CEBUDV. The values in bold are the distances obtained within each lineage.
	Clade A		Clade B		Clade C
Lineage	I	II	III	IV	V	VI	VII
I	0
II	3.83	0.06
III	17.28	16.73	0.24
IV	19.42	18.33	4.04	0
V	26.03	24.90	28.35	26.99	0
VI	26.49	25.94	28.73	26.71	1.60	0
VII	27.96	27.38	28.24	27.54	3.02	2.61	0

The greatest genetic distance was 28.73%, which was observed between the ethnovarieties caupuri with nodes and caupuri without nodes (lineage III) and native mariri (lineage VI). The shortest genetic distance (1.6%) was observed between lineage V (sample PF5) and lineage VI (sample SA3) (Table 3).

In the NCBI database, there is only one ITS accession for B. caapi (accession number LC496605), and this showed an identity percentage ranging from 85.33–95.43% after comparison with sequences presented (Table S2). Trees were constructed using the NJ and ML methods in which this accession of the ITS for B. caapi from the NCBI was included and this grouped with the samples of clade A (Fig. S2). The ITS marker presented 135 informative sites for parsimony and an average genetic distance of 14.59% (Table 4).

Table 4

Information sites for parsimony and mean genetic distances (in percentage) for markers evaluated in samples of the *mariri* ethnovarieties of *Banisteriopsis* spp., which are used in the preparation of ayahuasca in the Amazon by the CEBUDV.
Markers	Parsimony sites	Distances	S.E
ITS	135	14.59	0.0120
yage5	37	3.25	0.0047
MP3	0	0.16	0.0009
matK	3	0.08	0.0005
ndhF	2	0.15	0.0010
rbcL	1	0.04	0.0004
matK + ndhF + rbcL	6	0.09	0.0004

The phylogeny of the anonymous marker yage5 presented two clades (A and B) (Fig.S3). Clade A represents most of the samples that were collected in the crops at the CEBUDV. Only the VM5 sample, which was collected in a cultivation environment, was grouped with the samples collected in a natural environment, in clade B. The genetic distance between clades A and B for the yage5 marker was 6.88% and the mean genetic distance was 3.25% (Table 4).

Two clades with a bootstrap of 71 were identified in the ML phylogeny of the MP3 nuclear marker (Fig. S4). All the samples that were collected in a cultivation environment were grouped in clade A, while in clade B are grouped the samples collected in a natural environment. The genetic distance between clade A and clade B was 0.29%, and the mean genetic distance was 0.16% (Table 4), which are the shortest distances when compared with the other nuclear markers analyzed in the present study.

Plastid markers

The three plastid markers matK (1,301 bp), ndhF (687 bp) and rbcL (1,290 bp) resulted in 3,278 bp analyzed, and these presented the lowest indices of genetic diversity when compared to the nuclear markers (Table 2). The number of polymorphic sites ranged from 1 (rbcL) to 3 (matK and ndhF), with a number of haplotypes ranging from 2 (rbcL) to 4 (ndhF), and haplotypic diversity ranging from 0.505 (rbcL) to 0.696 (ndhF). The highest nucleotide diversity was 0.00487 (ndhF). None of the three plastid markers showed indels.

The mean genetic distances estimated for each of the three markers (rbcL, matK, and ndhf) were less than 0.15% (Table 4). The NJ and ML trees for these three markers (rbcL, matK, and ndhf)) showed no more than two bootstrap values greater than 90 (Fig.S5). BLAST N analysis for these markers identified all samples as being of the genus Banisteriopsis (Table S3, S4, and S5).

The phylogenetic trees (NJ and ML) with the three concatenated plastid markers (rbcL, matK, and ndhF) included nucleotide sequences of 19 samples of Banisteriopsis spp. that are used in the preparation of ayahuasca and the seven species of Banisteriopsis that have sequences for the three markers available on GenBank (Davis and Anderson 2010). Although the phylogenetic analyses (NJ and ML) supported clade with a bootstrap of 99, it included all of the 19 samples analyzed in the present study and B. caapi and B. schwannioides, which are species identified at the morphological and genetic level by Davis and Anderson (2010) (Fig. S6). The mean genetic distance for the concatenated plastid markers was only 0.09% (Table 4).

This is the first report of the efficiency of six molecular markers as potential DNA barcode for the evaluation of their genetic diversity and the identification of ethnovarieties of Banisteriopisis spp. used for the preparation of ayahuasca in the Amazon, in the religious context of CEBUDV. Combining the results of the genetic diversity, the ability to differentiate groups of ethnovarieties in the phylogenetic trees, and patterns of genetic divergence. Our results support the designation of ITS as the main barcode DNA locus for the identification of ethnovarieties of Banisteriopisis spp. In addition, the inclusion of at least one of the three analyzed plastid markers (matK, rbcL or ndhF) as an additional locus is recommended since the combination of nuclear and plastid information gives more reliability to the dataset. They did enable the confirmation of the genus Banisteriopsis, although plastid markers do not increase the taxonomic power of identification of species and ethnovarieties.

Genetic diversity and BLAST N

The nuclear markers presented the highest rates of genetic diversity when compared to plastid markers, which is a fact that has been observed for over 54 families of Amazonian angiosperms such as Sapotaceae and Rubiaceae (Gonzalez et al. 2009; Mezzasalma et al. 2017). In forty-nine genera of Amazonian angiosperms, the highest rates of genetic diversity were observed with the ITS (Gonzalez et al. 2009). In eighteen samples of piri-piri (Cyperus spp.), which are also used in traditional Amazonian medicine, eight haplotypes have been observed for the ITS (Mezzasalma et al. 2017). High genetic diversity was observed with 14 haplotypes, for the 15 and 16 samples of Banisteriopsis spp. that were sequenced in the present study for yage5 and ITS, respectively, although we had achieved 80% (16 samples) sequencing efficiency for ITS and 75% (15 samples) for yage5. The difficulty in sequencing for ITS has already been observed in other studies (Gonzalez et al. 2009).

Some regions of the plastid genome have relatively slow rates of nucleotide replacement (Clegg et al. 1994), which may have favored the results of lower indices of genetic diversity found in the analyzed samples (Table 2). Despite the plastid markers matK and rbcL being recommended as DNA barcode for plants (Hollingsworth et al. 2009), they were highly conserved in the 20 samples of Banisteriopsis spp vines. The three plastid markers analyzed (matK, rbcL, and ndhF) presented only three polymorphic sites and four haplotypes (Table 2) and, in this sense, were not variable enough to discriminate the ethnovarieties. In addition, the comparison of plastid markers in the NCBI sequence database with the 19 species of Banisteriopsis identified at the morphological level by Davis and Anderson (2010) presented a percentage of identity ranging from 99–100% for all 19 species (Table S3, S4, and S5). Therefore, for Banisteriopsis spp., the plastid markers on their own are not variable enough to separate and identify species.

On the other hand, for the nuclear marker ITS, the BLAST N analysis resulted in a percentage of identity ranging from 85.33–95.43% after comparison with the only accession of the ITS for B. caapi (Table S2). These molecular identification applications depend on the existence of complete reference libraries of DNA sequences with which new sequences can be compared to perform taxonomic identification (De Lima et al. 2018). If a reference library has poor coverage in terms of species with sequences already available, the implementation of DNA-based identification techniques will remain inefficient. Thus, this work presents an important contribution with new accessions of nuclear and plastid sequences of Banisteriopsis spp. for the NCBI database, especially when we consider Banisteriopsis spp.

Testing the discrimination of ethnovarieties based on phylogenetic trees and distance methods

The three clades (A, B, and C) that were differentiated by the molecular marker ITS are represented by lineages of the three main ethnovarieties of Banisteriopsis spp.; tucunacás, caupuris, and pajezinho, respectively (Fig. 2). These ethnovarieties are recognized by traditional knowledge in the context of CEBUDV, but they can also be recognized by other names when we consider the indigenous context and other religions.

In clade A, it was possible to identify two lineages of Banisteriopsis spp. of the tucunacá ethnovariety, one is a lineage cultivated (I) in the Mestre Angílio nucleus in Manaus and the other a native lineage (II) of Presidente Figueiredo. The only accession of B. caapi available in the NCBI for ITS presented the highest percentage values of identity concerning specimens of lineage II, from the native tucunacá ethnovariety (ranging between 95.24% and 95.43%; Table S2).

The Banisteriopsis spp. that were identified in lineage III and IV (clade B) are ethnovarieties of caupuri with nodes and without nodes and presented the highest phenotypic plasticity of the stem (Fig. 2d and Fig. S1), and all were collected in cultivations in Manaus. Of the eight samples (lineage III), four presented the phenotype with nodes and the other four without nodes, corroborating the traditional knowledge that recognizes the caupuri ethnovariety by this characteristic (with nodes and without nodes). The caupuri with nodes was recognized and introduced to the CEBUDV in the 1960s. At this time, marked by the beginning of the CEBUDV in the city of Manaus, Mestre Florêncio Carvalho, who was a rubber tapper in the Amazon Rainforest for many years, carried out some searches for Banisteriopsis spp. in the forests of the banks of the Negro River, where the caupuris (with nodes) were encountered.

Clade C presented the greatest amount of lineages (V, VI, and VII) and these are represented by the ethnovariety identified as pajezinho, which is two natives (V and VI) and one cultivated lineage (VII). Pajezinho is recognized for having one of the strongest effects in ayahuasca after its preparation (Fig. 2). As such, the pajezinho ethnovariety can be confused with the tucunacá ethnovariety because neither possess nodes. However, the lineages of clade C were genetically differentiated from the others, including within the same clade (Table 3), in which it is possible to observe that the cultivated lineage (VII) resulted in a genetic distance of 3.02 and 2.61% for the native lineages V and VI, respectively.

In addition to the phenotype of the vine, which aids in the identification of ethnovarieties, the quality of the visions under the influence of ayahuasca tea is often described as an important characteristic for identification (Schultes 1986). Therefore, we must emphasize that although the phenotype of the vine is very important for the identification of ethnovarieties, these characteristics should be used with caution. When we specifically consider the phenotype of the vine, the ethnovarieties of native lineages (lineages II, V, VI) have phenotypes that are similar to each other (Fig. S1), but are not recognized as being the same ethnovariety by members of the CEBUDV (Table S1), and are genetically different from each other.

Thus, the results presented partially unravel the enigma described by Schultes (1986), who reported the difficulty of recognizing morphological differences as a way of separating ethnovarieties from each other. In our genetic analyses, all known ethnovarieties in the traditional context of the CEBUDV were separated by genetic analyses based on the nuclear molecular marker ITS. However, the comparison of our results with analyses of ethnovarieties known in other religions and traditional peoples is important. Since the revision of the genus Banisteriopsis, there are reports of the difficulty in differentiating species morphologically, due to the morphological floral characters being conserved (Gates 1982). Therefore, part of the botanical riddle described by Schultes (1986) remains.

All the vines analyzed are used in the preparation of ayahuasca tea, although we still do not have morphological evidence that all the samples analyzed in fact belong to the botanical species B. caapi. However, the phenotype of the with nodes stem of two samples (FN2 and MA1) of lineage III (clade B) is similar to the phenotype of the ethnobotanical specimen of B. caapi (formerly Banisteria caapi Spruce ex Griseb.) held in the Economic Botany Collection, at the Royal Botanic Gardens, Kew (EBC 67428), which was collected in the Amazon by Richard Spruce in 1852 (Nesbitt 2014). These observations lead us to believe that representatives of clade B do in fact they can belong to the botanical species B. caapi.

The genetic distance thresholds, resulting from the ITS marker, between the lineages and ethnovarieties identified for the Banisteriopsis spp. vines were larger than we could expect within a single species and presented values of up to 28.73% (Table 3) of genetic distance (mean 14.59%). The assumption for the effectiveness of barcode DNA is that the genetic distances within the species are always smaller than the genetic distances between species, which is called the barcode gap. It is critical to determine these ranges of genetic distances between species of different taxonomic groups (Hebert et al. 2003). However, the genetic distances found in the present study for the vines used in the preparation of ayahuasca tea (Table 3) may indicate that more than one species of Banisteriopsis is used, and not only B. caapi, as most references mention (Gates 1982; Schultes 1984; Schultes et al. 1992). It is evident that integrative taxonomy studies are necessary to test this hypothesis.

For the piri-piri, another Amazonian species, which before was thought to be only a Cyperus articulatus species used in the traditional context, four species were identified, with genetic distance values ranging from 2.7 to 4.7% (Mezzasalma et al. 2017). The genetic distance with the ITS gene for tropical trees of 49 families of angiosperms was 6.23%, which is a value that is lower than the maximum found in the present study (28.73%) for the genus of Amazonian liana (Banisteriopsis).

Although in the results we did not present combinations of two markers (nuclear and plastid) in a single barcode to discriminate the ethnovarieties, we observed that this did not improve the overall performance when compared to single marker (ITS), which was also observed for other Amazonian angiosperms (Gonzalez et al. 2009).

The ITS presented the highest indices of genetic diversity among the markers evaluated and showed a greater correspondence between the ethnovarieties of Banisteriopisis spp. used in ayahuasca tea and recognized by the traditional knowledge of the CEBUDV, concerning the identified genetic lineages. These results may be relevant for the establishment of conservation measures for the ethnovarities of Banisteriopisis spp. that have traditional and religious use. We also demonstrate that traditional knowledge is remarkable and can be tested by scientific methods. We encourage new integrative studies like this one, which combines modern approaches and traditional knowledge, to contribute to the maintenance of traditional knowledge as well as the conservation of species.

Competing Interests

The authors declare there is no conflict of interest.

Funding

We thank the Centro Espírita Beneficente União do Vegetal (CEBUDV) for the partial funding of the project “Molecular identification and estimation of the genetic variability of Banisteriopsis caapi (mariri), based on chloroplast and nuclear genes” about the coordination of A.S.C.M. The Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq); the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) for the scholarship granted for T.Z.L. and A.S.C.M. during the study. This study It was also financed in part by CAPES (finance Code 001) and Governo do Estado do Amazonas, Secretaria de Estado de Desenvolvimento Econômico, Ciência, Tecnologia e Inovação (SEDECTI), Fundação de Amparo à Pesquisa do Estado do Amazonas (FAPEAM) POSGRAD and PAPAC 2019 financial support.

Author Contributions

A.S.C.M.: Idealized and conceptualized this study. A.S.C.M and T.Z.L.: collected the needed samples. T.Z.L.: Generated the data. A.S.C.M and T.Z.L: Processed the statistical analyzes and phylogenetic. A.S.C.M and T.Z.L.: Prepared the figures. T.Z.L. wrote the first draft of the manuscript. A.S.C.M and T.Z.L.: Wrote the manuscript final. J.S.B. Supervised and oriented the execution of that study. All authors reviewed and approved the manuscript.

Acknowledgments

We also thank the brothers and sisters of CEBUDV who contributed to the collection the samples of mariri. We would like to thank also the Programa de Pós Graduação em Genética, Conservação e Biologia Evolutiva (PPG-GCBEv/INPA) and the Instituto Nacional de Pesquisas da Amazônia (INPA) for the institutional support; and Laboratório Temático de Biologia Molecular (LTBM/INPA) for the use of their infrastructure where this study was developed. This work forms a portion of M.Sc dissertation T.Z.L. at the PPG-GCBEv/INPA. In memory of Mestre Angílio de Jesus and Mestre José Gabriel the founder CEBUDV.

CEBUDV. 2022a (Centro Espírita Beneficente União do Vegetal). Quem Somos (https://udv.org.br/en/about-us/ ) Accessed: 01/03/2022
CEBUDV. 2022b (Centro Espírita Beneficente União do Vegetal). Mariri e Chacrona. (https://udv.org.br/en/hoasca-tea/mariri-and-chacrona/ ) Accessed: 01/03/2022
Altschul SF, Gish W, Miller W, et al. (1990) Basic local alignment search tool. Journal of Molecular Biology 215:403–410. https://doi.org/10.1016/S0022-2836(05)80360-2
Billotte N, Lagoda PJL, Risterucci AM, Baurens FC (1999) Microsatellite-enriched libraries: applied methodology for the development of SSR markers in tropical crops. Fruits (Paris) 54:277–288
Callaway JC, Brito GS, Neves ES (2005) Phytochemical Analyses of Banisteriopsis Caapi and Psychotria Viridis. Journal of Psychoactive Drugs 37:145–150. https://doi.org/10.1080/02791072.2005.10399795
Cameron KM, Chase MW, Anderson WR, Hills HG (2001) Molecular systematics of Malpighiaceae: evidence from plastid rbcL and matK sequences. American Journal of Botany 88:1847–1862
Cattanio JH, Barbosa JBF, Corrêa MA (2011) Conservação genética do mariri (Banisteriopsis sp) e Chacrona (Psychotria sp) banco de germosplasma. In: In Costa, J. B. Hoasca, ciência, sociedade e meio ambiente. Embrapa, Campinas: Mercados das letras, p 360 p
Clegg MT, Gaut BS, Learn GH, Morton BR (1994) Rates and patterns of chloroplast DNA evolution. Proceedings of the National Academy of Sciences 91:6795–6801. https://doi.org/10.1073/pnas.91.15.6795
Davis CC, Anderson William RIR, Donoghue MIJ (2001) Phylogeny of Malpighiaceae: evidence from chloroplast ndhF and trnl-F nucleotide sequences. American Journal of Botany 88:1830–1846. https://doi.org/10.2307/3558360
Davis CC, Anderson WR (2010) A complete generic phylogeny of Malpighiaceae inferred from nucleotide sequence data and morphology. American Journal of Botany 97:2031–2048. https://doi.org/10.3732/ajb.1000146
De Lima RAF, De Oliveira AA, Colletta GD, et al (2018) Can plant DNA barcoding be implemented in species-rich tropical regions? A perspective from São Paulo State, Brazil. Genetics and Molecular Biology 41:661–670. https://doi.org/10.1590/1678-4685-gmb-2017-0282
Dos Santos RG, Hallak JEC (2019) Ayahuasca, an ancient substance with traditional and contemporary use in neuropsychiatry and neuroscience. Epilepsy & Behavior 106300. https://doi.org/10.1016/j.yebeh.2019.04.053
Felsenstein J (1985) Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39:783–791. https://doi.org/10.1111/j.1558-5646.1985.tb00420.x
Gates B (1982) Banisteriopsis, Diplopterys (Malpighiaceae). New York Botanical Garden Press
Gonzalez MA, Baraloto C, Engel J, et al (2009) Identification of Amazonian trees with DNA barcodes. PLoS ONE 4:. https://doi.org/10.1371/journal.pone.0007483
Green MR, Sambrook J (2012) Molecular cloning: a laboratory manual, 4th ed. Cold Spring Harbor Laboratory Press, New York
Hibert F, Sabatier D, Andrivot J, et al. (2011) Botany, genetics and ethnobotany: A crossed investigation on the elusive tapir’s diet in French Guiana. PLoS ONE 6:. https://doi.org/10.1371/journal.pone.0025850
Hollingsworth PM, Forrest LL, Spouge JL et al. (2009) A DNA barcode for land plants. Proceedings of the National Academy of Sciences 106:12794–12797. https://doi.org/10.1073/pnas.0905845106
Katoh K, Standley DM (2013) MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Molecular Biology and Evolution 30:772–780. https://doi.org/10.1093/molbev/mst010
Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of molecular evolution 16:111–120
Koressaar T, Remm M (2007) Enhancements and modifications of primer design program Primer3. Bioinformatics 23:1289–1291. https://doi.org/10.1093/bioinformatics/btm091
Kumar S, Stecher G, Li M et al. (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35:1547–1549. https://doi.org/10.1093/molbev/msy096
Langdon EJ (1986) Las clasificaciones del yagé dentro del grupo Siona: etnobotánica, etnoquímica e historia. In: América Indígena XLVI. pp 101–116
Mezzasalma V, Bruni I, Fontana D et al. (2017) A DNA barcoding approach for identifying species in Amazonian traditional medicine: The case of Piri-Piri. Plant Gene 9:1–5. https://doi.org/10.1016/j.plgene.2016.11.001
Mishra P, Kumar A, Nagireddy A et al. (2016) DNA barcoding: An efficient tool to overcome authentication challenges in the herbal market. Plant Biotechnology Journal 14:8–21. https://doi.org/10.1111/pbi.12419
Monteles R (2020) “Eu venho da floresta”: A Sustentabilidade das plantas sagradas amazônicas do Santo Daime. PhD Thesis. Universidade Federal do Amazonas (UFAM). Manaus Amazonas, Brasil.
Nesbitt M (2014) Use of herbarium specimens in ethnobotany. In: Salick J, Konchar K, Nesbitt M (eds) Curating Biocultural Collections: A handbook. Royal Botanic Gardens Kew. pp 313-328.
Newmaster SG, Ragupathy S (2010) Ethnobotany genomics - discovery and innovation in a new era of exploratory research. Journal of Ethnobiology and Ethnomedicine 6:2. https://doi.org/10.1186/1746-4269-6-2
Ogalde JP, Arriaza BT, Soto EC (2009) Identification of psychoactive alkaloids in ancient Andean human hair by gas chromatography/mass spectrometry. Journal of Archaeological Science 36:467–472. https://doi.org/10.1016/j.jas.2008.09.036
Oliveira LC, Rodrigues DP, Hopkins MJG (2017) Comparação de seis protocolos de extração de DNA para análises moleculares em espécies de Fabaceae. Scientia Amazonia 6:38–45
Platt AR, Woodhall RW, George AL (2007) Improved DNA sequencing quality and efficiency using an optimized fast cycle sequencing protocol. BioTechniques 43:58–62. https://doi.org/10.2144/000112499
Rozas J, Ferrer-Mata A, Sanchez-DelBarrio JC et al. (2017) DnaSP 6: DNA sequence polymorphism analysis of large data sets. Molecular Biology and Evolution 34:3299–3302. https://doi.org/10.1093/molbev/msx248
Schultes RE (1984) Psychoactive plants in need of chemical and pharmacological study. Proc Indian Acad Sci (Plant Sci) 93:281–304
Schultes RE (1986) Recognition of variability in wild plants by Indians of the Northwest Amazon: An enigma. Journal of Ethnobiology 6:229–238
Schultes RE (1979) The Amazonia as a Source of New Economic Plants. Economic Botany 33:259–266
Schultes RE, Hofmann A, Ratsch C et al. (1992) Plants of the gods: their sacred, healing, and hallucinogenic powers. Rochester, Healing Arts Press
Stamatakis A (2014) RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30:1312–1313. https://doi.org/10.1093/bioinformatics/btu033
Stanford AM, Harden R, Parks CR (2000) Phylogeny and biogeography of Julglans (Juglandaceae) based on matK and ITS sequence data. American Journal of Botany 87:872–882
Untergasser A, Cutcutache I, Koressaar T et al. (2012) Primer3 - new capabilities and interfaces. Nucleic Acids Research 40:1–12. https://doi.org/10.1093/nar/gks596
White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: a guide to methods and applications. Academic Press Inc, pp 315–322

Luzetal.2022SupplementaryMaterial.docx

Download PDF

Editorial decision: Major revisions
20 May, 2022
Reviews received at journal
24 Mar, 2022
Reviewers invited by journal
21 Mar, 2022
Editor assigned by journal
07 Mar, 2022
First submitted to journal
06 Mar, 2022

You are reading this latest preprint version

First DNA barcode efficiency assessment for an important ingredient in the Amazonian ayahuasca tea: mariri/jagube, Banisteriopsis (Malpighiaceae)

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

DNA sampling and extraction

Development of the genomic library

Amplification and sequencing of nuclear and plastid DNA markers

Analysis of DNA sequence data

Results

Genomic Library

Nuclear markers

Plastid markers

Discussion

Genetic diversity and BLAST N

Testing the discrimination of ethnovarieties based on phylogenetic trees and distance methods

Conclusion

Declarations

Competing Interests

Funding

Author Contributions

Acknowledgments

References

Supplementary Files

Status:

Version 1