The effects of ethyl lauroyl arginine hydrochloride( ELAH) in nasal spray on SARS-C0V-2

doi:10.21203/rs.3.rs-1432140/v1

Download PDF

Research Article

The effects of ethyl lauroyl arginine hydrochloride( ELAH) in nasal spray on SARS-C0V-2

https://doi.org/10.21203/rs.3.rs-1432140/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

In 2019, a coronavirus caused an outbreak of severe respiratory syndrome in Wuhan, China, and the virus was identified as severe acute respiratory syndrome-coronavirus-2 (SARS-CoV-2). The aim of the study was to investigate the broad-spectrum antiviral effects of ethyl lauroyl arginine hydrochloride (ELAH) against SARS-CoV-2 in vitro and in cell cultures. In vitro treatment of pseudovirus VSV-SARS-CoV-2 expressing the receptor binding domain of SARS-CoV-2 for 10 minutes at 37°C with 15 µg/ml and 110 µg/ml ELAH inhibited virus replication in Vero cells by 55% and over 90%, respectively. Intranasal administration of Syrian golden hamsters with SARS-CoV-2 pretreatedin vitro with ELAH for 10 minutes at 37°C not only inhibited the disease symptoms typically caused by SARS-CoV-2 in hamsters but also concomitantly reduced the total RNA viral load and the subgenomic RNA compared with the control non-ELAH group. In vitro treatment of the Delta variant of SARS-CoV-2 at 37°C for 10 minutes with 200 µg/ml ELAH inhibited replication in Vero E6 TMPRS-2 cells by 2 logs. To elucidate the mechanism of the action of ELAH, MRC-5 cells were pretreated with various concentrations of ELAH followed by infection with HCoV-229E. The data presented show that ELAH inhibited the cytopathic effects induced by the virus in MRC-5 cells. High-resolution electron microscopy of MRC-5 cells pretreated with ELAH prior to infection showed significantly reduced progeny virions on the surface of the infected cells. These results suggest that the primary mode of action of ELAH in MRC-5 cells is most likely due to the lack of attachment of the virus to the aminopeptidase N (APN) receptor, thus affecting the entry and subsequent replication of the virus in infected cells. The results presented in this study suggest that ELAH in nasal spray formula could be a promising virucidal agent for the prevention of coronavirus infections, including SARS-CoV-2 infections through the nasopharynx.

Virology

In December 2019, a novel coronavirus (SARS-CoV-2) emerged in Wuhan, China, and the virus rapidly spread throughout the world (Koopmans M. 2020). The World Health Organization (WHO) declared the outbreak a pandemic in March 2020 (Koopmans M. 2020). This highly contagious respiratory disease was called coronavirus disease 2019 (COVID-19). COVID-19 caused by SARS-CoV-2 enters the host via the respiratory route and infects the lungs and other organs of the body (Gandhi RT, and others, 2020). Since the port of entry of the virus is via the nasopharynx, we present data with regard to the efficacy of ELAH, in nasal spray formula, in preventing the virus from causing a severe disease.

The compound N-alpha-lauroyl-L-arginine ethyl ester monohydrochloride (LEAH or ELAH - FDA designation) is a derivative of lauric acid, arginine and ethanol. The main characteristic of this molecule is that it prevents the proliferation and colonization of microbial films in oral and nasal mucosal surfaces (Gallob, J.T. et al, 2015). ELAH is hydrolyzed in the human body by chemical and metabolic pathways, which break the molecule into natural compounds in the human diet (Hawkins, D.R. 2009). The US Food and Drug Administration (FDA) has approved ELAH and classified it as generally recognized as safe (GRAS) and effective for use in meats and poultry as a food preservative (FDA 2005 GRAS notice. GRN 000164, no objection letter from FDA Sept 2005: The EFSA journal (2002)511;1-27).

The antiviral and virucidal activity of arginine surfactants, such as L-cocoyl-L-arginine ethyl ester, against herpes simplex (HSV-1&2), influenza A and polioviruses (PV-1) has been extensively studied by Yamasaki and his group (Yamasaki, H. et al, 2011). They studied N-alpha-cocoyl-L-arginine ester (CAE) and cocoyl glycine potassium salt (Amilite) among other salts and compared their activity with other surface-active agents, such as benzalkonium chloride (BAC) and sodium dodecyl sulfate (SDS), and found that CAE at a concentration of 0.01% was most effective in inhibiting HSV-1 and PV-1. Yamasaki and his group indicated that CAE could be useful for preventing skin infections caused by HSV-1. However, lauric acid ester of arginine (ELAH) was not included in their studies.

In this report, we present the results of studies conducted in vitro and in cell cultures on the effect of ELAH in nasal spray formulation on SARS-CoV-2, including the Delta variant, and on human coronavirus-229E under different experimental conditions. Studies with Syrian golden hamsters suggest that ELAH in nasal spray formulation can be used as an effective tool in combating the spread of SARS-CoV-2 and other coronaviruses.

Viruses SARS-CoV-2 (WA-2020) and the widely transmitted Delta variant hCoV-19/USA/MD-HPO567/2021 were obtained from the National Institutes of Health (NIH, Bethesda, MD, USA) and subsequently grown in Vero cells and in V-TMPRESS-2 cells, respectively, at the Bioqual Laboratory. Human coronavirus (HCoV-229E) was obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) and grown in Vero cells.

Generation of Pseudovirus VSV-SARS-CoV-2. Single-cycle pseudoparticles were generated using a vesicular stomatitis virus (VSV) genome encoding the firefly luciferase reporter gene (Whitt, M.A. 2010) instead of the native viral glycoprotein (ΔG-VSV-Luc). Infectious virus particles were produced by transiently expressing the native VSV glycoprotein by transfection (G*ΔG-VSV-Luc). Briefly, HEK293T cells (American Type Culture Collection, ATCC, VA, USA) were transfected with a plasmid expressing the SARS-CoV-2 spike protein using Lipofectamine LTX reagent (Life Technologies, CA, USA); pSARS-CoV-2-Sdel18 with a C-terminal 18 amino acid truncation was shown to increase infection efficacy (Xiong, Y. et al. 2020). After 24 hours of transfection, the cells were infected with G*ΔG-VSV-Luc at a multiplicity of infection (MOI) of 3 and then incubated for 24 hours. Cell supernatants containing SARS-CoV-2 pseudotyped (VSV-SARS-CoV-2) virus were collected, centrifuged at 1,200 rpm for 5 minutes, filtered through a 0.2 micron filtering device, aliquoted, and frozen at -80°C. VSV-SARS-CoV-2 virus preparation was quantified using Vero cells (ATCC) seeded at 50,000 cells per well in clear bottom black 96-well plates and incubated for 24 hours at 37°C in minimum essential medium (MEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 1X penicillin/streptomycin/L-glutamine. Cells were inoculated with a 1:2 dilution series of pseudotyped virus in 100 μl of MEM for 24 hours at 37 °C. Luciferase activity was quantified with 100 μl of Bright-Glo reagent (Promega, WI, USA), and relative light units (RLU) were read on a Cytation 5 Imaging Multi-Mode Reader (BioTek, CA, USA) plate reader. The dilution generating approximately 10,000 RLU was selected for experiments described below.

Preparation of ethyl lauroyl arginine hydrochloride (ELAH) in nasal spray formula: The stock solution contained 1.0 mg/ml of ELAH, glycerin (10.0%), polyvinyl pyrrolidone (1.0%), 1,2-hexanediol, PEG-40 hydrogenated castor oil, phenoxyethanol and cupric gluconate as preservatives, sodium hydroxide (qs), citric acid (qs) for buffer and deionized distilled water to 100%.

Neutralization of pseudovirus VSV-SARS-CoV-2 infectivity by anti-hyperimmune rat serum against the SARS-CoV-2 receptor binding domain: Vero cells were seeded in 96-well black, clear bottom tissue culture-treated plates (Corning, Corning, NY) at 50,000 cells/well in growth medium and incubated at 37°C for 24 hours. Cells were allowed to reach approximately 85% confluence.

VSV-SARS-CoV-2 (approximately 10,000 RUL) was mixed at a ratio of 1:1 with serial dilutions of hyperimmune serum against the receptor binding domain (RBD) of SARS-CoV-2 or with medium only (control) and incubated for 1 hour at 37°C. Vero cells were infected with VSV-SARS-CoV-2 treated with anti-hyperimmune serum or with untreated control virus and incubated for 24 hours at 37°C. Virus yield was determined by RLU counts. Luciferase activity was quantified with 100 μl of Bright-Glo reagent (Promega), and relative light units (RLU) were read on a Cytation 5 (BioTek, Winooski, VT) plate reader.

In vitro effect of ELAH on the replication of pseudovirus VSV-SARS-CoV-2 in Vero cells: Vero cells were seeded in 96-well black, clear bottom tissue culture-treated plates at 50,000 cells/well in DMEM for 24 hours at 37°C. Cells were allowed to reach approximately 85% confluence before the assay was performed. ELAH was diluted in medium to a 2X assay concentration and diluted 2-fold down in variable pressure scanning electron microscopy (VP-SFM) medium for an 8-point dilution curve in the assay beginning at 200 µg/ml. Pseudo VSV-SARS-CoV-2 particles were diluted 1:20 in media for an RLU count of 10,000 in the assay. Various dilutions of ELAH starting with 200 µg/ml were mixed 1:1 with VSV-SARS-CoV-2 in triplicate and incubated at 37°C for 1 hour. ELAH-treated and untreated control virus samples were used to infect Vero cells and incubated for 24 hours at 37°C. Virus yield was determined by adding Bright-Glo reagent (Promega-delete Promega). Plates were read immediately, and RLUs were quantitated using the Cytation 5 Cell Imaging Multi-Mode Reader. Exported values were analyzed using Microsoft Excell XLFit (5.5) software.

Animal Model Studies: Golden Syrian hamsters were chosen as the animal model for this study based on recent publications indicating that Syrian golden hamsters are a small animal model for COVID-19 (Tostanoski, L. H. et al. 2020, Imai, M. 2020). A total of 21 male and female golden Syrian hamsters (6-8 weeks old, approximately 100 g in weight) were purchased from Envigo RMS, Inc., Indianapolis, IN, USA. Animal acclimation and husbandry followed the procedures and practices outlined in the Institutional Animal Care and Use Committee (IACUC) Study Protocol. Housing and handling of the animals were performed in accordance with the animal welfare requirements and accreditations stated below.

The animal study was conducted in BIOQUAL’s animal facility (BIOQUAL, Inc. Rockville, MD, USA), which is the Approved Animal Welfare Assurance (OLAW) assured (A-3086-01), United States Department of Agriculture (USDA) registered (51R 036) and has full Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) Accreditation (File no. 624). In addition, BIOQUAL has Centers for Disease Control (CDC)/USDA approval for working with restricted BSL-2 and BSL-3 select agents and has approved ABSL/BSL-3 facilities and training for working with infectious agents under containment. Based on the final study plan, BIOQUAL prepared, submitted, and received approval for the IACUC protocol. BIOQUAL Study Directors of both Animal/Veterinary Services and Laboratory Services reviewed the IACUC protocol submission to ensure that all scheduled procedures were consistent with the approved final study plan. This nonclinical study was performed under the BIOQUAL IACUC approved protocol (Number: 20-153P) and was conducted in accordance with the study protocol and BIOQUAL Standard Operating Procedures (SOPs).

Experimental Design and Grouping: These experiments were conducted in collaboration with BIOQUAL and Merck research scientists.

Study 1: The retention of ELAH after a single administration followed by mock challenge was examined for 20 minutes. A total of six animals were divided equally into three groups. ELAH (50 µl/nare) was administered to each nare of all the animals. Ten minutes post-ELAH administration, animals in Group 1 received 50 µl per nare of mock infection consisting of Delbecco’s modified Eagle’s medium (DMEM) containing 2% fetal bovine serum (FBS). Fifteen minutes after ELAH administration, animals in Group 2 received the mock infection, and 20 minutes after ELAH administration, animals in Group 3 received the mock infection. Leakage of the solution was monitored for 10 min after each mock infection in all three groups.

Study 2: The in vitro effect of ELAH on the pathogenesis of SARS-CoV-2 to cause clinical disease in hamsters was examined. A total of 15 animals were equally divided into three groups of 5 each.

Group 1 Animals were challenged with SARS-CoV-2 (1x10⁶ PFU/ml), treated in vitro with undiluted ELAH (1 mg/ml) diluted in DMEM and incubated at 37°C for 10 minutes. Following incubation, each animal was challenged nasally with 0.05 ml of treated virus/nare, corresponding to 2x10⁴ PFU/nare) as described in detail below.

Group 2: Animals were challenged with SARS-CoV-2 and treated in vitro with ELAH as in group 1, with the exception that ELAH (1 mg/ml) was diluted 1:1 with phosphate buffered saline (PBS) prior to incubation with SARS-CoV-2 under similar experimental conditions as in Group 1.

Group 3 (control): The same concentration of SARS-CoV-2 (1x10⁶PFU/ml) was diluted in DMEM and incubated at 37°C for 10 minutes. Following incubation, each animal was challenged as described in Group 1.

Procedure for Hamsters Challenged with SARS-CoV-2: SARS-CoV-2 treated with ELAH or untreated control virus from the three animal groups described above was administered intranasally (IN) to anesthetized hamsters and performed in a BSL-3 laboratory. The administration of virus was conducted as follows: Using a calibrated pipettor, 0.05 ml of the viral inoculum was administered dropwise into each nare, that is, 0.1 ml/animal, while the animal's head was tilted back so that the nare was pointing toward the ceiling. The syringe was introduced into the first nare, slowly injected into the nasal passage, and then removed. This was repeated for the second nare. The animal’s head was tilted back for approximately 20 seconds and then returned to its housing unit and monitored until fully recovered.

Body weights were measured once daily during the 14-day challenge phase. The animals were monitored twice daily during the morning and afternoon for clinical symptoms of COVID-19 (ruffled fur, hunched posture, labored breathing) during the study period, starting on the day of SARS-CoV-2 challenge, and the information was recorded on BIOQUAL clinical observation forms and/or the Pristima® database. The raw data for the body weights and the clinical observations were made and recorded.

Collection of Oral Swabs for SARS-CoV-2 Replication Studies: Oral swabs were collected from control and SARS-CoV-2-infected animals during days 1 through 4 and on day 7 post challenge. Scheduled euthanasia and necropsies were carried out for each animal at the end of the experiment.

Specimen Processing for Viral RNA and Viral Segmented RNA Assays: For viral load assays of oral swabs, the samples were processed as follows. Upon collection, the swabs were placed into 1 ml of phosphate buffered saline (PBS) and then snap-frozen. Samples were then thawed, and an aliquot of the sample was used for RNA isolation following the manufacturer’s instructions (Qiagen, MD, USA)

Quantitation of SARS-CoV-2 RNA in Syrian Golden Hamsters: The qRT-PCR assay was used for quantitation of viral RNA from oral swabs using primers and a probe specifically designed to amplify and bind to a conserved region of the nucleocapsid gene of coronavirus (forward primer: 5’-GAC CCC AAA ATC AGC GAA AT-3’; reverse primer: 5’-TCT GGT TAC TGC CAG TTG AAT CTG-3’ and probe: 5’-FAM-ACC CCG CAT TAC GTT TGG TGG ACC-BHQ1-3’) as described previously (Baum, A. et al. 2020). Regeneron, a cocktail made of two noncompeting neutralizing human IgG 1 antibodies (REGN-CoV2) that target the receptor binding domain (RBD) of the SARS-CoV-2 spike protein, thereby preventing viral entry into human cells via the angiotensin-converting enzyme 2 (ACE2) receptor. REGN-CoV-2 antibodies have been shown to prevent and treat SARS-CoV-2 infections in rhesus macaques and hamsters (Baum, A. et al. 2020). The signal was compared to a known standard curve and calculated to give copies/ml. For the qRT-PCR assay, viral RNA was first isolated from oral swabs using the Qiagen Min Elute virus spin kit (Qiagen, MD, USA). To generate a control for the amplification reaction, RNA was isolated from the SARS-CoV-2 virus using the same procedure as mentioned above. The amount of RNA was determined by O.D. reading at 260 nm (A260), using the estimate that 1.0 OD at A260 equals 40 µg/mL of RNA. With the number of known bases and the average base of RNA weighing 340.5 g/mole, the number of copies was then calculated, and the control was diluted accordingly. A final dilution of 10⁸ copies per 3.0 µl was then divided into single-use aliquots of 10 µl and stored at -80°C. For the master mix preparation, 2.5 ml of 2X buffer containing Taq-polymerase, obtained from the TaqMan RT-PCR kit (Bioline, Meridian Biosciences, Inc., OH, USA), was added to a 15 ml tube. From the kit, 50 µl of RT and 100 µl of RNase inhibitor were also added. The primer pair at a 2 µM concentration was then added in a volume of 1.5 ml. Finally, 0.5 ml of water and 350 µl of the probe at a concentration of 2 µM were added, and the tube was vortexed. For the reactions, 45 µl of the master mix and 5 µl of the sample RNA were added to the wells of a 96-well plate. All samples were tested in triplicate. The plates were sealed with a plastic sheet. For control curve preparation, samples of the control RNA were prepared to contain 10⁶ to 107 copies/3.0 µl. Eight (8) 10-fold serial dilutions of control RNA were prepared using RNase-free water by adding 5.0 µl of the control to 45 µl of water and repeating this for 7 dilutions. This generated a standard curve with a range of 1 to 10⁷ copies/reaction. For amplification, the plate was placed in an Applied Biosystems 7500 Sequence detector and amplified using the following program: 48°C for 30 minutes, 95°C for 10 minutes followed by 40 cycles of 95°C for 15 seconds, and 1 minute at 55°C. The number of copies of RNA/ml was calculated by extrapolation from the standard curve and multiplying by the reciprocal of the 0.2 ml extraction volume.

Subgenomic RNA quantitation: The quantitation of subgenomic RNA (sgRNA) was carried out by an RT-qPCR assay as described by Wölfel, R. et al (2020)).

The primers and probe selected from the N gene (Forward:

5’-CGATCTCTTGTAGATCTGTTCTC-3’; reverse: SG-N-R: 5’-GGTGAACCAAGACGCAGTAT-3’ and probe: 5’-FAM- TAACCAGAATGGAGAACGCAGTGGG -BHQ-3’) were similar to what was previously described (Li et al. 2021). The PCR signal obtained with the sample was compared to a known standard curve of plasmid containing the sequence of part of the messenger RNA and calculated to give copies/ml. To generate a control for the amplification reaction, a plasmid containing a portion of the N gene messenger RNA was used. A final dilution of 106 copies/3.0 µl was then divided into single-use aliquots of 10 µl and stored at -80°C until needed. The samples extracted for viral RNA were then amplified in duplicate to pick up sgRNA. Seven (7) 10-fold serial dilutions of control RNA were prepared by adding 5.0 µl of the control to 45 µl of water and repeating this for 7 dilutions, leading to the generation of a standard curve with a range of 1x 10⁶ copies/reaction. For amplification, the plate was placed in an Applied Biosystems 7500 Sequence detector and amplified using the following program: 48°C for 30 minutes, 95°C for 10 minutes followed by 40 cycles of 95°C for 15 seconds, and 1 minute at 55°C. A printout of the results is maintained in the laboratory notebook. The number of copies of RNA/ml was calculated by extrapolation from the standard curve and multiplying 0.2 ml of extracted volume.

In Vitro Treatment of SARS-CoV-2 Delta Variant with ELAH: The variant used in this study is a widely transmitted Delta variant, hCoV-19/USA/MD-HPO5647/2021. The antiviral effect of ELAH on the Delta variant was conducted in the Vero-TMPRSS2 cell line (NIH, Bethesda, MD) expressing TMPRSS-2 protein (Shutoku, M. et al. 2020). This cell line is highly susceptible to SARS-CoV-2 infection and is used for the isolation and propagation of SARS-CoV-2 variants.

The Delta variant (37 PFU) was incubated with 100 and 200 μl/ml of ELAH at 37°C for 10 minutes in a total volume of 600 µl of DMEM containing 10% FBS. As a control, the Delta variant was suspended in a total of 600 µl of DMEM. The antiviral activity of ELAH was then determined by TCID₅₀ assay. Briefly, Vero-TMPRSS2 cells (25,000 cells/well) were plated in a 96-well plate in DMEM and incubated for 24 hours at 37°C. The medium was removed, 200 µl of the ELAH-Delta variant mixture or 200 µl of control virus was added to Vero-TMPRSS-2 cells in quadruplicate, and the plate was re-incubated for 60 minutes at 37°C. After 60 minutes of incubation, the ELAH virus inoculum and the control virus inoculum were removed from each well, and the cells were washed and replenished with 200 µl of fresh medium. Cultures were re-incubated at 37°C for 72 hours. The antiviral effect of ELAH on the Delta variant was determined by TCID₅₀ assay in Vero-TMPRSS-2 cells as the dilution of virus showing 50% reduction of PFU at a given dilution.

Effect of ELAH on Human Coronavirus-Induced Cytopathic Effects in MRC-5 Cells by Bright Field Microscopy and Scanning Electron Microscopy: MRC-5 cells were seeded at 1x10⁵ cells/ml in 4-chamber cell culture slides and incubated at 37°C for 4 days until approximately 85-90% confluency was obtained. Two concentrations of ELAH, 1 µg/ml and 10 µg/ml, in DMEM were added to the cells and incubated for 10 minutes at 37°C. Cell cultures treated with medium only were used as controls. ELAH was then removed from the cell cultures and infected with a 10³ dilution of stock HCoV-229E (log₁₀TCID₅₀/ml 5.625), and cultures were re-incubated at 35°C for 2 hours. Similarly, cells not treated with ELAH were also infected with 229E. After an adsorption period of 2 hours, the cells were washed to remove unabsorbed virus, refed with medium and incubated for 48 hours at 37°C. Control cultures were treated in a similar manner. After 48 hours, chamber cell cultures were imaged via bright field microscopy at a magnification of X63.

Following bright field imaging, select samples were fixed and processed for scanning electron microscopy (SEM) imaging at the University of Wyoming per Methods and Materials. Samples were fixed with 1 ml glutaraldehyde for 2 hours and processed according to the procedure of Caldas et al. (2020). After the samples underwent fixation, they were placed in a Kinney Vacuum KSE-2A-M Evaporator under 10^-4Torr vacuum for 24 hours and then sputtered with a 5 nm thick gold coat using a Model 30000 Ladd Research Industries apparatus. SEM imaging was conducted at the Materials Characterization Laboratory, University of Wyoming, WY, USA. Secondary electron and backscattered electron images were collected on a Quanta 250 scanning electron microscope under 10^-5Torr vacuum using an accelerating voltage of 5 kV and spot sizes of 2 and 3. Electronic alignments on the electron gun (Gun Alignment, Final Lens Aperture Alignment, and Stigmator Alignment) were performed prior to imaging to optimize resolution.

Neutralization of pseudovirus VSV-SARS-CoV-2 infectivity by anti-hyperimmune serum against the SARS-CoV-2 receptor binding domain: VSV-SARS-CoV-2 expressing firefly luciferase activity was mixed with serial dilutions of hyperimmune rat serum against the receptor binding domain (RBD) of SARS-CoV-2 or with medium only (control) and incubated for 1 hour at 37°C as described in the Materials and Methods. Vero cells were then infected with virus treated with hyperimmune serum or with untreated control virus, and yield was determined by RLU counts as described in the Materials and Methods. The neutralization of VSV-SARS-CoV-2 by the anti-RBD of SARS-CoV-2 is presented in Figure 1. The results show that a 50% reduction in virus yield was obtained with a dilution of 1:5,000 of the anti-RBD antibodies in the hyperimmune serum. Presumably, the neutralization reached a plateau at 70% because the antibodies used were not purified against the RBD of SARS-CoV-2. The results suggest that the anti-RBD antibodies of SARS-CoV-2 bind to the spike protein of VSV-SARS-CoV-2 and thus prevent the attachment and replication of VSV-SARS-CoV-2 in Vero cells under these experimental conditions. This is consistent with the literature reports that antibodies to RBD prevent the attachment of SARS-CoV-2 to the receptor on the cell (Tostanoski, L. H. et al. 2020).

In vitro effect of ELAH on the replication of pseudovirus VSV-SARS-CoV-2 in Vero cells: VSV-SARS-CoV-2 was diluted in medium to obtain an RLU of approximately 10,000. Various dilutions of ELAH starting with 200 µg/ml were mixed 1:1 with VSV-SARS-CoV-2, and for the control, the virus was mixed 1:1 with medium, and the samples were incubated for 1 hour at 37°C. After the incubation period, a constant amount of treated virus and control virus were used to infect Vero cells and incubated for an additional 24 hours at 37°C as described in the Materials and Methods. After 24 hours, RLU values were calculated. The inhibition of VSV-SARS-CoV-2 replication by in vitro treatment with various concentrations of ELAH is shown in Figure 2. Maximum inhibition of over 90% was obtained by treatment of the virus with 110 µg/ml and 200 µg/ml ELAH. These results suggest that ELAH either binds to or alters the spike protein of VSV-SARS-CoV-2 to prevent it from attachment to the ACE2 receptor on Vero cells and thus prevent the next steps in the replication process.

The effect of ELAH on SARS-CoV-2 pretreated in vitro and applied intranasally in Syrian Golden Hamsters to cause Clinical Disease: Studies have shown that Syrian Golden hamsters are a useful animal model for studying the pathogenesis of SARS-CoV-2 (Tostanoski, L. H. et al. 2020; Baum, A. et al. 2020). SARS-CoV-2 is a respiratory virus, and the virus enters the host via the respiratory route. An antiviral nasal spray is a possible route for the delivery of therapeutics as a preventive measure (Tostanoski, L. H. et al. 2020; Baum, A. et al. 2020). The following series of experiments were conducted with Syrian golden hamsters to evaluate the effect of in vitro treatment of SARS-CoV-2 with ELAH prior to intranasal infection of hamsters on the development of clinical symptoms typically observed following SARS-CoV-2 challenge.

Preliminary experiments were conducted to determine the retention of ELAH when administered to hamsters intranasally as well as any secondary and adverse effects observed in these animals. As described in the Materials and Methods (Study 1), six animals were administered 50 µl of ELAH in each nare. Three groups of two animals each were then administered 50 µl of medium containing 2% FBS in each nare after 10, 15 and 20 minutes in each group (mock infection). No leakage was observed in experimental animals 10 minutes after mock infection. While some moisture around the nose is normal for this procedure, the amount of moisture could not be quantified.

It has been well documented that upon infection of hamsters with SARS-CoV-2 via the nasal route, one of the clinical symptoms observed is severe weight loss during the first few days of infection followed by recovery to normal weight (Tostanoski, L. H. et al. 2020). Weight loss has also been associated with the presence of virus in the respiratory tract (Tostanoski, L.H. et al, 2020). The following experiments were conducted to evaluate the effect of in vitro treatment of SARS-CoV-2 with ELAH on the ability of the virus to cause weight loss in hamsters.

For this study, 15 hamsters were divided into three equal groups. In group 1, SARS-CoV-2 was treated with 1 mg/ml ELAH and incubated at 37°C for 10 minutes prior to challenge with 0.05 ml/nare, corresponding to 2x10⁴PFU/nare as described in the Materials and Methods. In group 2, similar experimental conditions were used, except SARS-CoV-2 was treated with 0.5 mg/ml ELAH. For group 3 (control group), SARS-CoV-2 was incubated with medium only under similar experimental conditions prior to challenge of hamsters. The body weights of each hamster were measured once daily, and the animals were also monitored twice daily for signs of COVID-19 as described in the Materials and Methods. The body weight changes observed in all animals during the course of 14 days are shown in Figure 3A. The results show that the animals infected with SARS-CoV-2 only (control group) had a significant loss of weight during the first six days after challenge. These animals regained their original weight during the next eight days, as has been reported previously (Tostanoski, L. H. et al. 2020). In contrast, SARS-CoV-2 treated with both concentrations of ELAH showed no significant weight loss during the 14-day course of the study. Similar results were also obtained with all female (Figure 3B) and male animals (Figure 3C). These results suggest that the treatment of SARS-CoV-2 with ELAH under these experimental conditions significantly inhibits the ability of the virus to induce weight loss, a major indicator of clinical disease.

Previous reports have shown that weight loss in hamsters infected with SARS-CoV-2 is associated with the viral load in the respiratory tract of infected animals (Imai, M et al. 2020; Baum, A. et al. 2020). To correlate the weight loss in the animals, oral swabs were collected from animals in the three groups on days 1 through 4 and on day 7 postexposure to SARS-CoV-2 treated with ELAH and analyzed for the presence of viral RNA and viral sgRNA as described in the Materials and Methods. This time period was selected since the maximum weight loss of animals in the control group was observed during this time period (Figures 3 A, 3 B and 3C).

The results presented in Figure 4 show that in control group 3, all animals challenged with SARS-CoV-2 alone were positive for viral RNA on days 1 through 4 and on day 7. An average of 1.9 x105 copies of viral RNA/ml was found in control group 3. In contrast, SARS-CoV-2 treated with 1 mg/ml ELAH (Group 1) showed significantly lower levels of viral RNA during the first 3 days post challenge, with an average of less than 1x10³ RNA copies/ml (Figure 4). On days 4 and 7, all animals had less than 1x10³ RNA copies/ml except for 2 animals on day 4. In group 2 animals, the level of viral RNA during the first 3 days post challenge was very similar to that found in group 1 animals. However, on days 4 and 7, the level of viral RNA increased in most animals. The results presented suggest that in vitro treatment of SARS-CoV-2 with 1 mg/ml or with 0.5 mg/ml ELAH prior to challenge with SARS-CoV-2 decreased the viral load by over 2 logs in all animals compared to that in the control group. This is the time period when weight loss was observed in these animals (Figure 3). No statistical analysis was performed with the data due to limited group size.

The results presented in Figure 5 show that in control group 3, all animals on days 1, 2 and 3 showed the presence of approximately 1x 10⁴ sgRNA copies/ml. On day 4, three out of five animals had less than 1 x 10³sgRNA copies/ml, and two had undetectable (less than 50 copies/ml) sgRNA. All animals showed the presence of sgRNA on day 7. In contrast, in group 1, where SARS-CoV-2 was treated with 1 mg/ml ELAH in vitro prior to challenge, all animals showed an undetectable number of copies of sgRNA on days 1, 2, 3, 4 and 7, with the exception of one animal that had a significant number of sgRNA copies on day 4 (Figure 5). In group 2, where SARS-CoV-2 was treated with 0.5 mg/ml ELAH in vitro prior to challenge, all animals had an undetectable number of sgRNA copies on days 1, 2, and 3, whereas on day 4, four out of 5 animals and on day 7, one out of 5 animals showed a significant number of sgRNA copies/ml (Figure 5). From these results, it appears that under these experimental conditions, the synthesis of SARS-CoV-2 sgRNA is more sensitive to the action of ELAH than viral RNA synthesis. These results are not unexpected since the synthesis of sgRNA depends on viral RNA synthesis and transcription.

In Vitro antiviral activity of ELAH on the Replication of SARS-CoV-2 Delta Variant in Vero E6-TMPRSS-2 Cells:

The effect of ELAH on the widely transmitted Delta variant hCoV-19/USA/MD-HPO567/2021 was evaluated by TCID₅₀in theVero E6 cell line constitutively expressing full length human transmembrane serine protease-2 (Vero-TMPRSS-2). This enzyme is expressed by endothelial cells in the respiratory tract and acts as a major priming enzyme relevant to viral entry and spread of SARS-CoV-2 (Hoffman, M. et.al. (2020). Briefly, 37 PFU of the Delta variant was incubated with various concentrations of ELAH at 37°C for 10 minutes, and the mixture and virus control were used to infect Vero-TMPRESS-2 cells as described in the Methods and Materials. After 72 hours, virus yield was determined by TCID₅₀assay in Vero-TMPRSS-2 cells. Preliminary experiments using 50 µg/ml or less ELAH did not produce significant inhibition of the SARS-CoV-2 Delta variant (data not shown). However, a marked decrease in TCID₅₀was observed when preincubated with 100 and 200 µg/ml ELAH (Figure 6). Based on the data presented in Figures 1 and 2, it is likely that during in vitro incubation of the Delta variant with ELAH, the virus spike protein involved in the entry process may have been altered to prevent entry into Vero-TMRSS-2 cells and further replication of the virus.

Inhibition of cytopathic effect by human coronavirus 229E in MRC-5 cells pretreated with ELAH by Bright Field Imaging. Many human coronaviruses (HCoVs) have been identified during the past several decades. Some, including SARS-CoV-2, are highly pathogenic in humans, whereas a few viruses cause mild upper respiratory tract infection in children, such as human coronavirus 229E (HCoV-229E; Dominguez, S.R. et al. 2009, Gagneur, A. et al. 2008). Although the basic genomic structure and replication of SARS-CoV-2 are similar to those of HuCoV-229E, differences have been shown to exist between these two viruses with regard to receptor-mediated entry into the cells of the respiratory tract. SARS-CoV-2 enters the cell via the angiotensin-converting enzyme 2 (ACE2) receptor (Lan, J. et.al. 2020; Mehidipour, A.R. & Hummer, G. 2021), whereas HCoV-229E uses aminopeptidase N (APN) as its receptor (Bonavia, A. et.al. 2003; Yeager, C.L. et.al. 1992).

Since our present studies with pseudo virus VSV-SARS-CoV-2 (Figures 1 and 2) suggest that ELAH may interfere with the entry of VSV-SARS-CoV-2 in Vero cells, the following experiments were conducted to determine the effect of ELAH on the ability of HCoV-229E to cause CPE in MRC-5 cells, an indication of viral replication. This system is useful in studying HCoV-229E outside the BSL-3 or BSL-4 level laboratory.

Briefly, MRC-5 cells were grown in chamber cell culture slides, pretreated for 10 minutes with nontoxic amounts of 1 µg/ml and 10 µg/ml ELAH or with medium (cell control) and infected with HCoV-229E and 48 hours post infection. Cultures were examined for CPE by bright field imaging (BFI) as described in the Materials and Methods. The cells were treated with medium only (cell control) (Figure 6A). or with 1 and 10 µg/ml ELAH (ELAH control). Figures 7C and 7D, respectively, show the normal fibroblast morphology of MRC-5 cells in culture. Cells infected with HCoV-229E (virus control) showed marked CPE, as evident by the rounding of infected cells and their lack of adherence to the surface of the chamber slide (Figure 7B). In contrast, MRC-5 cells pretreated with either 10 µg/ml (Figure 7E) or 1 µg/ml ELAH (Figure 7F) showed no significant CPE, as evidenced by the characteristic fibroblast cell morphology of the cell monolayers. These results suggest that pretreatment of MRC-5 cells with either 10 µg/ml or 1 µg/ml ELAH for 10 minutes prior to infection with HCoV-229E significantly inhibits virus-induced CPE.

High-resolution Scanning Electron Microscopy. Following bright field imaging (Figure 6), select samples were fixed and processed for scanning electron microscopy (SEM) imaging at the University of Wyoming as described in the Methods and Materials.

In HCoV-229E-infected cells (virus control), newly synthesized virus particles were observed on the surface of the cells 48 hours after infection (Figure 8a). MRC-5 cells (cell controls) are shown in Figure 8b. In contrast to Figure 8a, MRC-5 cells pretreated with 10 µg/ml ELAH prior to infection with HCoV-229E showed markedly reduced progeny virions on the surface of infected cells (Figure 7c). These results suggest that 10 minutes of pretreatment of MRC-5 cells with 10 µg/mL ELAH for 10 minutes prior to infection with HCoV-229E reduced viral entry and CPE caused by the virus after 48 hours of incubation compared to controls.

The primary mode of entry for SARS-CoV-2 is through the mucosa lining the respiratory system. While vaccines have been developed, other means, especially in the early stage of infections, are vitally important to arrest or reduce the transmission of virus through nasal passage. Effective antiviral therapies, especially in the early stage of infections, are vitally important to halt viral proliferation long enough for the immune system to respond to the virus, limit cellular damage inflicted by viral invasion and minimize genetic mutations caused by the high replication frequency of the virus, which might lead to therapeutic resistance.

Since COVID-19 was declared a pandemic in 2020, effective vaccines have been developed, although the current emphasis is on using facial masks, applying hand sanitizers and social distancing. Masks alone cannot protect against the highly transmissible SARS-CoV-2 that spreads through aerosols and droplets. Therefore, effective antiseptics administered via the nasopharynx or oral route are needed to reduce or prevent transmission. We used ELAH in a nasal spray formulation to prevent viral transmission. The antiviral and virucidal activities of arginine esters have been extensively studied by Yamasaki (Yamasaki, H. 2011; and Ohtake,S. (2010)), and they concluded that the Cocoly derivative of arginine inhibited virus replication of herpes simplex virus-1 (HSV-1) and poliovirus-1 (PV-1) at 0.01% and identified its potential application as a therapeutic or preventative medicine. We tested ELAH since it has been approved for use as a food preservative for meats and poultry. The main characteristic of this molecule is its unique surface activity. It has been shown that at very low concentrations, it reduced the surface free energy of protein-coated surfaces in oral and other mucosal surfaces from 25 dynes/cm to 15 dynes/cm. It has been shown that when the surface energy is reduced to 15 dynes/cm, no attachment of biofilms is observed on protein-coated mucosal surfaces, which prevents microbial films in vitro and in vivo (Glantz, P.O. 1981). Human clinical studies have confirmed these effects (Giersten, E. et al., 2007; Gallob, J.T. 2015).

In our study, we used a lauric acid derivative of arginine ester, ELAH, which was not investigated by Yamasaki, H (2011). Since ELAH is completely broken down into arginine and lauric acid in our body, (Hawkins, D.R. 2009), ELAH is ideal for topical nasal application.

The results presented in Figs. 1 and 2 show that in vitro treatment of pseudotype VSV-SARS-CoV-2 with ELAH significantly inhibited virus replication. This inhibition of virus replication is likely due to the binding or alteration of the receptor binding domain in the spike protein of the virus by ELAH to prevent attachment of the virus to the ACE2 receptor.

Studies have shown that Syrian golden hamsters are a useful animal model for studying the pathogenesis of SARS-CoV-2 (Tostanoski, L. H. 2020; Baum, A. et al. 2020). Our studies with Syrian golden hamsters showed a similar pattern as determined by weight loss and clinical symptoms (Figs. 4 and 5). Concomitant with the clinical picture, viral load as measured by genomic RNA and total sgRNA decreased in the treated group compared to the control group. The statistical significance was not determined due to the small numbers of animals.

The exact mechanism by which ELAH exerts its inhibitory effects on SARS-CoV-2 and the Delta variant as well as HCoV-229E (Figs. 2, 6 and 7) cannot be determined by the present study. However, the possibility exists, based on the data presented in Figs. 1 and 2, that the effect of ELAH on coronaviruses could be due to the ability of ELAH to alter the virus-cell surface interaction.

Three mechanisms were elucidated by Yamasaki et al. (2011): structural changes in the viral spike proteins, virus aggregation and pore formation in the virus envelope. The most likely mechanism, according to them, by which arginine (breakdown product of ELAH) inactivates the virus is most likely due to suppression of protein interactions with other molecules or surfaces. More importantly, they concluded that the effects of arginine were due to its weak interactions. Since ELAH is known to alter the surface properties of protein-coated mucosal surfaces via hydrophobic/hydrophilic interactions (Gallob, J. T,2015), it is reasonable to assume that its mode of action could be due to surface modifications suppressing the weak interactions between the virus and the susceptible cell surface.

Our studies with pretreatment of MRC-5 cells prior to infection with HCoV-229E inhibited CPE, suggesting an inhibition of virus replication (Fig. 7), and the SEM studies (Fig. 8) may further indicate that the inhibitory action of ELAH against the virus is likely due to modifying the surface characteristics of the MRC-5 cells, resulting in the ability of the virus to enter the cells.

Taken together, the data presented in this report suggest that ELAH in nasal spray formulation can be a useful tool in augmenting the layer of protection against SARS-CoV-2 in addition to vaccines and other therapeutic means.

Baum, A. et al. REGN-CoV-2 antibodies prevent and treat SARS-CoV-2 infection in rhesus macaques and hamsters. Science, 3701, 1110-1115 (2020)

Bonavia, A. et al. Identification of a receptor binding domain of the spike glycoprotein of Human Coronavirus HCoV-229E. J. Virol. 77, 2530-2538 (2003)

Caldas, L.A. et al. Ultrastructural analysis of SARS-CoV-2 interactions with the host cell via high resolution electron microscopy. Scientific Report. 10, 16099 (2020);https://doi.org/10.1038/s41598-020-73162-5

Dominguez, S. R. et al. Detection of four human Coronaviruses in respiratory infections in children: A one-year study in Colorado. J. Med. Virol. 81, 1597-1604 (2009)

Gagneur, A. et al. Outbreaks of human Coronaviruses in a pediatric and neonatal intensive care unit. Eur. J. Pediatr. 167, 1427-1434 (2008)

Gallob, J. T. A randomized trial of ethyl lauroyl alginate-containing mouthwash in the control of gingivitis. J. Clinical Periodontology 42,740-747 (2015)

Gandhi, R.T. Mild to moderate Covid-19. New Eng. J. Med. 383, 1757-1766 (2020)

Giersten, E, Guggenheim, B, Gemur, B (2007): Antiplaque effects of ethyl lauroyl arginase in situ: J. Dental Res. 86 (special issue) abstract 2299

Glantz, P.O. (1981) ‘Adhesion in oral cavity’. In Fundamentals and Application of Surface Interactions in the Oral Cavity (ed SA Leach), 49-64 (1981) Information retrieval Ltd. London

Hawkins, D.R. et al. Metabolism and pharmacokinetics of ethyl N(alpha)-L- lauroyl arginate hydrochloride in human volunteers. Food & Chemical Technology 47, 2711-2715 (2009)

Hoffman, M. et al. SARS-CoV-2 Entry Depends on ACE2 and TMPRESS2 and Is Blocked by a Clinically proven Protease Inhibitor. Cell. 181. 271-280 (2020)

Imai, M. et al. Syrian hamsters as a small animal model for SARS-CoV-2 076infections and counter measures development. Proc. Natl. Acad. Sci., 117, 16587-16595 (2020)

Koopmans, M. (2020) Novel coronavirus outbreak. What we know and what we don’t. Cell 180, 1034-1036

Lan, J. et al. Structure of the SARS-CoV-2 spike receptor binding domain bound to the ACE2 receptor. Nature 581, 215-220 (2020)

Li, D. et al. In vitro and In vivo functions of SARS-Cov-2 infection-enhancing and neutralizing antibodies, Cell 184, 4203-4219 (2021)

Mehidipour, A. R. & Hummer, G. Dual nature of human aCE2 glycosylation in binding to SARS-CoV-2 spike. Proc. Natl. Acad. Sci.118, (42)e 2106480118 (2021)

Ohtake, S. (2010): Arginine as a synergistic virucidal agent. J. Molecules 15, 1408-1424 (2010)

Roberts, A. et al. Severe Acute respiratory Syndrome Coronavirus Infection of Golden Syrian hamsters. J. Virol. 79, 503-511 (2005)

Shrivastava, V. M. & Maneby, N. Clinical efficacy of an osmotic antiviral and anti-inflammatory polymeric nasal film to treat Covid-19 Early phase respiratory Symptoms. J. Clinical Trials.13, 11-20 (2021)

Shutoku, M, et al. Enhanced isolation of SARS-CoV-2 by TMPRSS2 expressing cells. Proc. Natl. Acad. Sci. 117, 7001-7003 (2020).

Sia, S.F. et al. pathogenesis and transmission of SARS-CoV-2 in golden hamsters. Nature. 583, 834-838 (2020)

Tandon, R. Effective screening of SARS-CoV-2 neutralizing antibodies in patient serum using lentivirus particles pseudo typed with SARS-CoV-2 spike glycoprotein. Sci Rep. 10, 19076 (2020)

Tostanoski, L. H. et al. Ad26 vaccine protects against SARS-CoV-2 severe clinical disease in hamsters. Nature Medicine. 26, 1694-1700 (2020)

Whitt, M.A. Generation of VSV Pseudotypes Recombinant delta-G for studies of virus entry, identification of inhibitors and immune responses to vaccines. J. Virol. Methods.169, 365-374 (2010)

Wolfel, R. et al. Virological Assessment of Hospitalized Patients with Covid-2019. Nature. 581, 465-469 (2020)

Xiong, Yo, et al. Emerging Microbes and Infection Transcriptomic characteristics of bronchoalveolar lavage fluid and peripheral blood mononuclear cells in COVID-19 patients. Emerg. Microb Infect. 9, 761-770 (2020)

Yamasaki, H. Antiviral and Virucidal Activities of N alpha--Cocoyl-L- Arginine Ethyl Ester. Adv. Virol. Article ID 572868 (2011)

Yeager, C. L. et al. Human aminopeptidase N (hAPN), a cell surface metalloprotease serves as a receptor. Nature 357, 420-422 (1992)

Conflict of interest: Dr. Thacore is a consultant in Virology for Salvacion USA Inc. with no financial interest in the company; Drs. Gaffar and Yun are part of Salvacion USA Inc. which has interest in commercializing the spray; Drs. Chenine (IBT), Ferrari, Pal and Wattay (Bioqual) and Peterson (Perfectus) are independent contractors conducting the studies described in the communication.

Author contributions: Drs. HT and AG wrote and edited the main manuscript text and supervised the experiments; Dr. SY developed the formulation. Drs. AC, MF, RP, LW and MP conducted the respective studies.

Download PDF

Version 1

posted

You are reading this latest preprint version

The effects of ethyl lauroyl arginine hydrochloride( ELAH) in nasal spray on SARS-C0V-2

Status:

Version 1

Abstract

Figures

Introduction

Experimental Section

Results

Discussion

References

Declarations

Status:

Version 1