Ethics, consent, and permissions
This study was approved by the Ethics Committee of Baqiyatallah University of Medical Sciences (Code: IR.BMSU.REC.1398.217). Written consent was obtained from all patients who were informed that the data would be used for research. CRC was confirmed based on clinical examination, colonoscopy, and histopathology tests on isolated biopsies. We excluded the patients who had undergone chemotherapy, radiotherapy or have other cancers or other diseases that affect the digestive system. Baqiyatallah Research Center for Gastroenterology and Liver Diseases (Baqiyatallah University of Medical Sciences) approved all aspects of this study.
Bioinformatics Analysis
We used circBase on-line database (available at: http://www.circbase.org/) to identify the predicted CYP24A1 related circRNAs. The hsa_circ_0060927 had been selected based on pervious studies [8, 13, 14]. Next, we retrieve the sequence of hsa_circ_0060927 from circBase for primer design using CircPrimer software [15]. We used the miRNAs predicted target list reported by Zhong Zh et al. They showed that hsa_circ_0060927 was up-regulated in bladder carcinoma by microarray assay. They also predicted that hsa-miR-224-3p, hsa-miR-29b-1-5p, hsa-miR-522-3p, hsa-miR-661 and hsa-miR-1264 as hsa_circ_0060927 targets [14]. Then we filtered and set the shared value of these miRNAs by TargetScan (http:// targetscan.org/vert_71/). Subsequently, DIANA-miRPath (http://diana.imis.athenainnovation.gr/DianaTools/index.php?r=mirpath/index) and DAVID (https://david.ncifcrf.gov/) functional annotation online tools were used to identify target genes and pathways.
Patients And Tissue Specimens Collection
A total of 83 fresh CRC samples and paired adjacent normal tissues were obtained from the Baqiyatallah Research Center for Gastroenterology and Liver Diseases between January 2016 and January 2017 (Baqiyatallah University of Medical Sciences). Tumor samples were taken from the CRC tissue during surgical procedure. All samples were immediately frozen in liquid nitrogen and stored at − 80 °C.
Cell Lines And Culture Conditions
The human colon cancer HT-29 and HCT-116 cell lines were purchased from Pasteur Institute (Tehran, Iran). Cell lines were grown in RPMI-1640 medium (Gibco, USA) supplemented with 10% (v/v) fetal bovine serum and 1% penicillin/streptomycin (Sigma, St. Louis, MO). All cells were cultured in a humidified incubator containing 5% CO2 at 37˚C. In brief, HT-29 and HCT-116 cells (1 × 105/well) were seeded into 6-well plates and treated with 10 µM 1, 25-(OH)2D3 and harvested at 48 hours post-treatment.
RNA extraction and reverse transcription
Total RNA was directly extracted from the colorectal tissues, normal mucosa, and cell lines using a GeneAll Hybrid-R™ RNA purification kit (Geneall Biotechnology Co. Ltd, Seoul, Korea) as described by the manufacturer’s protocol. RNA was visualized on 1% agarose gel to evaluate the RNA integrity. Additionally, the quantity and the quality of the total extracted RNA was estimated using NanoDrop® ND-1000 spectrophotometer (Thermo Fisher Scientific, USA). The RNA purity was evaluated according to the A260/A280 ratio. First-strand cDNA was synthesized from 1 µg of extracted total RNA using a Revert Aid First-Strand cDNA Synthesis Kit with random primers according to manufacturer-provided instruction (Thermo Fisher Scientific, USA).
Quantitative real-time PCR (qRT-PCR) condition and gene expression analysis
The qRT-PCR analysis was performed on an ABI StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA) using 2.0X RealQ-PCR Master Mix® with SYBR Green (Ampliqon, Odense, Denmark). The primer sets for CYP24A1 and Beta-2-microglobulin (β2M) genes were designed by Allele ID 6 software (Premier Biosoft, Palo Alto, USA) (Table 1). Each reaction consisted of 10 µl 2X RealQ-PCR Master Mix®, 1 µl cDNA (10 ng), 1 µl of each primer (10 pmol) and 7 µl of nuclease-free water to conduct PCR in a 20 µl of reaction mixture. We carried out the reactions in duplicate and β2M gene was used as normalization control. This gene was selected according to previous research for identification of housekeeping control genes in colorectal cancer [16]. Two-step thermal cycling and real-time data acquisition were performed using the following conditions: 95 °C for 15 min × 1 cycle, and 95 °C for 15 s, followed by 60 °C for 1 min × 40 cycles followed by melt curve stage assessment. The melting curve profile and agarose gel electrophoresis were performed to verify the specificity of primers and the authenticity of the PCR products.
Table 1
Genes | Primers | Sequences | Amplicon size (bp) |
CYP24A1 | Forward primer | CATTTGGCTCTTTGTTGGATTGTC | 145 |
| Reverse primer | CACCATCTGAGGCGTATTATCG | |
hsa_circ_0060927 | Forward primer | TAATACGCCTCAGGGAAGG | 196 |
| Reverse primer | GACCATTTGTTCAGTTCGCT | |
Beta-2-microglogulin | Forward primer | TGTCTTTCAGCAAGGACTGGT | 143 |
| Reverse primer | TGCTTACATGTCTCGATCCCAC | |
Statistical analysis
The qRT-PCR amplification efficiency was assessed using LinRegPCR software (version: 2017.1) and for each sample, the cycle threshold (Ct) and mean PCR efficiency were determined. We analyzed the experimental data using GraphPad Prism 7.0 (GraphPad Software, La Jolla, CA). All results are expressed as the mean ± SD of two independent experiments. The correlations between CYP24A1 and hsa_circ_0060927 expression levels and the clinicopathological factors of the CRC patients were assessed using a two-tailed t-test. The receiver operation characteristic (ROC) curve was established to estimate the diagnostic values of CYP24A1 and hsa_circ_0060927 expression levels. P < 0.05 was considered statistically significant.