Thyroid –pineal axis: Melatonin, circadian clock genes expression and vitamin D in Hashimoto's thyroiditis patients

doi:10.21203/rs.3.rs-1498029/v1

Objective

Evaluate Melatonin, circadian clock genes; brain and muscle aryl hydrocarbon receptor nuclear translocator-like 1 (BMAL-1), Period 2 (PER2) & nuclear factor kabba B (NF-Kb), sirtuin 1 (SIRT-1), Toll-like receptor 4 (TLR-4), tumor necrosis factor alpha (TNF-α) genes expression and vitamin D in Egyptian patients with Hashimoto thyroiditis (HT). Methods: 240 Egyptian volunteers (Egyptian healthy females and Egyptian females with HT). All participants were susceptible to laboratory investigations including and gene expressions.

Results

The current study revealed increased serum thyroid-stimulating hormone (TSH), anti-thyroid peroxidase antibody (anti TPO-Ab) and anti- thyroglobulin antibody (anti Tg-Ab) in the HT group. On the other hand, decreased serum concentration of melatonin, vitamin D, free tetraiodothyronine (FT4), free triiodothyronine (FT3), ionized calcium & blood hemoglobin in the HT group. Also, our results revealed that the gene expression of the BMAL-1, PER2 and SIRT-1 were downregulated in the HT group. On the contrary, the levels of gene expression of NF-kB, TLR-4,TNF-α genes were upregulated in the HT group.

Conclusions

We concluded that there is an association between HT and circadian rhythms approved by downregulation of Bmal-1 and PER2 genes expression Also, it may lead to an inflammatory response and oxidative stress. The significant decrease of serum melatonin levels in HT patients, strongly suggests an association between the melatonin pathway and HT. So, Melatonin may be recommended as supplementation for HT patients.

Hashimoto thyroiditis

Circadian rhythms

Melatonin

Vitamin D

Circadian clock genes

antibodies

Thyroid –pineal axis.

Hashimoto thyroiditis (HT) is an autoimmune endocrine disease. It is defined by the presence of antibodies to thyroid enzyme called thyroid peroxidase (TPO), and antibodies to thyroid protein called thyroglobulin (Tg).Thyroid tissue is attacked by these antibodies leading to insufficient production of thyroid hormones. This disease appears more frequently in females than males by 4–10 times [1, 2].

Organisms are subjected to numerous rhythmic activities, as regular and seasonal cycles. Organisms have evolved biological clocks to better respond to these cyclic environmental changes. In nearly all cells of the body, an approximately 24-h cell-autonomous circadian clock is present and this circadian system closely controls physiological functions and endocrine rhythms [3].

The circadian clock, which consists of interlocked transcriptional-translational feedback loops, is regulated by circadian rhythms. During the daytime, circadian locomotor production cycle kaput (CLOCK) and brain and muscle aryl hydrocarbon receptor nuclear translocator-like 1 (BMAL1) transcription factors heterodimerize and bind to elements of the E-box promoter to drive Duration (Per1-3) and Cryptochrome (Cry1/2) gene expression. Numerous disorders, including inflammatory and immunological diseases, have been associated with circadian clock disruption [4, 5].

The pineal gland primarily synthesizes melatonin (MLT), and its release is blocked by light to the retina but stimulated by darkness. MLT binds to membrane-bound receptors of MT1 and MT2, and contribute in controlling circadian and seasonal rhythms, as well as acting as an antioxidant, scavenger of free radical, and an adjuvant for cancer [6, 7]. MLT has been extensively explored as a potential therapeutic strategy for multiple autoimmune diseases due to its prominent immunoregulatory activity [8].

Vitamin D plays a vital function in the homeostasis of calcium and in the growth and skeleton maintenance. It is referred to fat soluble vitamin. Importantly, vitamin D and thyroid hormones bind to the same receptors known as steroid hormone receptors. There have been studies of a different gene in the vitamin D receptor predisposing individuals to autoimmune thyroid disease, including Graves' disease [9, 10].

Sirtuins are histone deacetylases that are linked to numerous metabolic pathways, as stress response and aging [11, 12]. Sirtuin 1 (SIRT1) is a subform located in the nucleus that has recently been shown to be not only regulated by the VDR, but also interpreted by deacetylation of forkhead box protein O3a (FOXO3a) as a mediator of anti-proliferative VD signals. This indicates a possible key role for the signaling of VD-SIRT1-FOXO3a in immune regulation [13–15].

Toll-like receptors (TLRs) are remaining receptors for pattern recognition produced on different tissues and play a critical role in innate immune system regulation. Activation of TLR leading to innate immune response activation and the production of mediators of inflammation as TNF-α and interleukin (IL-6, IL-12, IL-18). Also stimulate Nuclear factor-kappa B (NF-κB) activation, which translocates into the nucleus and enhance proinflammatory genes expression [16]. NF-κB implicated in normal thyroid physiology. For normal thyroid development and function, it is essential and is implicated in the expression of several genes unique to the thyroid, such as TPO, Tg [17, 18].

2.1 Participants

Approval is taken by Medical Research Institute Ethical Committee, University of Alexandria, then permission was obtained from each participant. The research was performed for studies involving humans according to the World Medical Association's Code of Ethics (Declaration of Helsinki).

This case – control study was done within 2 years period from January 2018 to December 2019. The participants were selected by convenient sampling from the general population. They were divided into two groups: Group I (Control group): 120 normal healthy Egyptian females aged 20–45 years with the mean ± SD of 35 ± 11.56 years, Group II (Patients group): 120 Egyptian females with newly diagnosed untreated Hashimoto’s thyroiditis, matched with age with the group I.

Exclusion criteria: Patients with a history of other endocrinopathies of the immune system, those with a history of medications known to impair thyroid functions, and/or thyroid immunity (interferon or glucocorticoids), patients with Diabetes, malignancy and patients using Melatonin supplements were excluded from the study.

Venous blood was withdrawn from all subjects in the morning at 9 AM and collected into two tubes; 2 ml of blood were collected into vacuum tubes containing EDTA as an anticoagulant for assessment of Bmal-1, PER2, TNF-α, SIRT-1, NF-κB, and TLR-4 gene expressions, and hemoglobin concentration. The remaining blood was then put into the serum vacutainer, allowed to clot for 30 min, and then centrifuged at 4,000 rpm for 10 minutes at room temperature to obtain serum for assessment of Melatonin, Vitamin D, TSH, Free T4, Free T3, Anti-TPO, Anti-Tg, and Ionized calcium

2.2 Methods:

2.2.1 Determination of serum TSH [19], FT₃, FT₄ [20] levels.

TSH, FT₃, FT₄ was determined using an electrochemiluminescence immunoassay on Roche Elecsys immunoassay analyzers.

2.2.2 Determination of serum anti TPO-Abs and anti Tg-Abs levels [21].

Anti TPO-Abs and anti Tg-Abs levels were determined using an electrochemiluminescence immunoassay on Roche

2.2.3 Determination of serum ionized calcium (Ca^+ 2) [22].

Serum ionized calcium was measured by an automated ion-selective electrode analyzer.

2.2.4 Determination of blood hemoglobin concentration (Hb) [23].

Hb level was measured using Sysmex count full automation hematology analyzer.

2.2.5 Determination of serum melatonin [24].

Melatonin was determined by using ELISA kits purchased from Bioneovan Co., Ltd. absorbance was measured at 450 nm.

2.2.6 Determination of serum vitamin D [25].

Vitamin D3 was determined by immunoturbidimetric kits purchased from spectrum Company for Biotechnology.

2.2.7 Gene expression of Bmal-1[26], PER2 [27], TNFα [28], SIRT-1 [29], NF-κB [30], and TLR-4 [31] by RT-PCR.

The total RNA was collected using the TRIzol RNA Isolation Technique (Invitrogen) from peripheral blood samples. Reverse transcriptase-polymerase chain reaction (RT-PCR) cDNA synthesis. The HiSenScript™ RH (-) cDNA Synthesis kit was purchased from iNtRON Biotechnology, Inc. In compliance with orders from the manufacturer. Using the SYBR Green PCR Kit, which is a convenient premix of the components (except primers, template, and water) needed to perform real-time PCR using SYBR® Green I Dye, relative quantification of gene expression was performed. By calculating the increase in fluorescence caused by the binding of SYBR® Green dye to double-stranded (ds) DNA, direct detection of the PCR product is controlled. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) housekeeping gene was used for normalization as a reference gene. Primers used for genes were as follows:

Gene	primer sequence
TLR-4	F:	5'- CACCTGTAGTGCTGTGTCGTT − 3'
TLR-4	R:	5'- TCACATCTGAGGGCACCTAAG − 3'
SIRT-1	F:	5'- AGAGCCTCACATGCAAGCTCTAG − 3'
SIRT-1	R:	5'- GCCAATCATAAGATGTTGCTGAAC − 3'
NF-κB	F:	GAGACATCCTTCCGCAAACT
NF-κB	R:	GTCCTTCCTGCCCATAATCA
TNF-α	F:	5'- CAGAGGGCCTGTACCTCATC-3'
TNF-α	R:	5'-GGAAGACCCCTCCCAGATAG-3'
Bmal-1	F:	5'- CACTGGAAGGAATGTCTGG-3'
Bmal-1	R:	5'-GGAAGACCCCTCCCAGATAG-3'
PER2	F:	5'- AGCCAATGAAGAGTATTACCAG-3'
PER2	R:	5'- GCCACCGCAAACATATCG-3'
GAPDH	F:	5'-ATCGTGGAAGGACTCATGACCACA-3'
GAPDH	R:	5'-TAGAGGCAGGGATGATGTTCTGGA-3'

Rotor-Gene Q-Pure Detection Version 2.1.0 (build 9) (Qiagen®, Valencia, CA, USA) has determined the threshold period (Ct) values. mRNA relative change in samples was calculated for each gene using the 2 − ΔΔCt method and normalized to the GAPDH housekeeping gene.

2.2.10 Statistical Analysis

The data was analyzed using version 18.0 of the SPSS software package (SPSS Chicago, IL, USA). The data were expressed mean ± SD and analyzed using an independent t-test to compare between two different groups and Pearson for correlation study. The P-value was assumed to be significant at p < 0.05 [32].

3.1 Thyroid function tests

Egyptian female patients with Hashimoto's thyroiditis showed a statistically significant increase in TSH level compared to healthy Egyptian female volunteers, percent of change 1225.2%. While, Egyptian patients with Hashimoto's thyroiditis showed a statistical significant decrease in FT3 and FT4 level compared to healthy Egyptian volunteers, percent of changes were (-33.1%, -44.1%) respectively. (Table 1)

3.2 Anti TPO-Abs and anti Tg-Abs

Egyptian female patients with Hashimoto's thyroiditis showed a statistical significant increase in anti TPO-Abs level and anti Tg-Abs levels compared to healthy Egyptian female volunteers, percent of changes are (1901.1%, 1975.5%) respectively. (Table 1)

3.3 Ionized Calcium and Hemoglobin Concentrations

Egyptian female patients with Hashimoto's thyroiditis showed a statistically significant decrease in serum Ca^+ 2 and Hb concentrations compared to healthy Egyptian female volunteers, percent of change are ( -11.1%, -24.2%) respectively. (Table 1)

Table (1): Laboratory tests in healthy Egyptian volunteers and Egyptian patients with Hashimoto's thyroiditis.

Variable	Control (n = 120)	HT patient (n = 120)	% of change
TSH (µIU/ml)	2.6 ± 0.66	34.7 ± 6.2 *	1225.2%
FT₃ (pg/ml)	2.5 ± 0.40	1.6 ± 0.56 *	-33.1%
FT₄ (ng/dl)	1.5 ± 0.25	0.8 ± 0.15 *	-44.1%
TPOAb (IU/ml)	11.4 ± 2.5	229 ± 34.4 *	1901.1%
TgAb (IU/ml)	15.6 ± 3.02	324.4 ± 73.7 *	1975.5%
Ca^+ 2 (mg/dl)	5 ± 0.17	4.4 ± 0.22 *	-11.1%
Hb (g/dl)	13.3 ± 0.62	10.1 ± 0.56 *	-24.2%
Data presented as Mean ± SD (n = 120)
*: significantly different from heathy individuals by independent t test (p < 0.05)

3.4 Serum Vitamin D

Egyptian female patients with Hashimoto's thyroiditis showed a statistical significant decrease in serum Vitamin D concentration compared to healthy Egyptian female volunteers, percent of change is -30.7% (Fig. 1).

3.5 Serum Melatonin (pg/ml)

Egyptian female patients with Hashimoto's thyroiditis showed a statistical significant decrease in serum melatonin concentration compared to healthy Egyptian female volunteers, percent of change is -48.6% (Fig. 2).

3.6 Gene expression of BMAL1, PER2, SIRT1 (fold change)

Egyptian female patients with Hashimoto's thyroiditis showed a statistical significant down regulation in BMALI, PER2 and SIRT1 expression compared to healthy Egyptian female volunteers, percent of changes are ( -90.1%, -70.7, -83.6%) respectively (Fig. 3,4,5).

3.7 Gene expression of TNFα, NF-κB, TLR4 (Fold change)

Egyptian female patients with Hashimoto's thyroiditis showed a statistical significant upregulation in TNFα, NF-κB, TLR4 expression compared to healthy Egyptian female volunteers, percent of change is (101.8%, 404.2%, 547.9%) respectively. (Fig. 6,7,8)

3.8 Correlation studies:

The statistical analysis using sperman correlation reveals that TSH level is directly correlated with anti Tg-Abs level (r = 0.446, p = 0.014, Fig. 9a) and inversely correlated with vitamin D concentration (r=-0.442, p = 0.015, Fig. 9b) in Egyptian female patients with Hashimoto's thyroiditis. PER2 expression is directly correlated with anti Tg-Abs level (r = 0.435, p = 0.016, Fig. 9c) and melatonin concentration (r = 0.506, p = 0.004, Fig. 9d) in Egyptian female patients with hashimoto's thyroiditis.

Hashimoto thyroiditis (HT) is an autoimmune disease, called chronic autoimmune thyroiditis in which thyroid cells are destroyed by antibodies [1]. As shown in our study increase in anti-TPO and anti-Tg antibodies.

In accordance to our finding, Barić, et al, 2018, found a significant increase in anti-TPO, Anti-Tg and TSH in individuals suffering from Hashimoto’s thyroiditis, and also found a significant decrease in FT₃ and FT₄ [33]. Our study showed a significant direct correlation between TSH level and Tg-Ab level (r = 0.446, p = 0.014, Fig. 9a).

Thyrocytes, are strictly epithelial cells that produce the thyroid hormones (FT₃ and FT₄) [34]. Cytokines produced by T-cells lead to expression of surface antigens HLA-DR in thyrocyte cells rendering them vulnerable to immune attack. Polyclonal antibodies are directed against the same epitopes in healthy individuals and patients. Good subjects' anti-TPO antibodies did not block TPO activity or interfere with the blocking activity of AITD patients' anti-TPO antibodies, while anti-TPO antibodies from patients with AITD may improve complement, Destroying thyrocytes and acting as competitive enzyme activity inhibitors [35, 36].

In the present study, low Hb level was observed in patient with HT. This was in accordance with Ahmed & Mohammed, 2020, who reported that low levels of hemoglobin are shown in hypothyroidism patients [37]. The occurrence of anemia in hypothyroidism is a common finding [38]. Iron is vital for the activity of thyroid peroxidase. Experimental tests have shown that iron deficiency reduces the activity of thyroid peroxidase and can also lead to the depression of thyroid function. Important negative associations between TSH and haemoglobin levels have been observed [39]. There is also a bilateral association between anaemia, thyroid and metabolic status. In hematopoiesis, especially in erythropoiesis, thyroid hormones play a crucial role. They stimulated proliferation of erythrocyte precursor, but they also promote erythropoiesis by increasing the expression of the erythropoietin gene and the development of erythropoietin in the kidneys [40, 41].

Several studies agreed with our finding concern to low calcium level in Hashimoto's thyroiditis patients [42–46]. Vitamin D is one of the hormones that regulate serum calcium and other minerals in blood. Our results also showed a significant decrease in (1,25(OH)₂D₃) in HT group. The deficiency of Vitamin D cause a decrease in serum calcium, as it promotes absorption of calcium from gut and also influences calcium and phosphorous bone turnover and renal excretion [47].

The association between vitamin D deficiency and thyroid autoimmunity has been demonstrated in several studies, such as the fact that cholecalciferol supplements are successful in reducing TPO-Abs in HT patients because they have anti-inflammatory and immunomodulatory functions [48]. Our study showed a significant inverse correlation between TSH level and vitamin D level (r=-0.442, p = 0.015, Fig. 9b).

TNF-α is a cytokine produced at inflammatory sites by activated macrophages and monocytes. TNF-α has been shown to be developed by thyroid epithelial cells in the thyroid tissue of patients with autoimmune diseases. The pathogenesis of thyroid diseases can contribute to this. Patients with acute thyroiditis, for example, is caused by viral infections, which are usually followed by TNF-alpha development in immunocompetent cells. In the regulation of thyroid growth and function, TNF-al is involved. Serum T3, T4 reduces administration of TNF-α to mice or rats [49]. ⁴⁹ That agrees with our finding which showed increase in TNF-α expression.

Sirtuins are histone deacetylases protein comprise of seven variants. Among them, SIRT1 has the strongest deacetylase activities. There is considerable evidence promoting the function of sirtuins in reacting through direct deacetylation of transcription factors controlling antioxidant genes to oxidative stress. Oxidative stress has been shown to be attenuated by SIRT1. The study done by Al-Khaldi & Sultan 2019 showed that downregulation of SIRT1 increased systemic oxidative stress [50] as shown in our study.

Hypothyroidism can affect peripheral circadian clocks [51–53]. As shown in our study, downregulation of Bmal-1 and PER2 genes expression in HT group. Perturbation of the circadian system can be distinguished by disturbance of the thyroid functions and cell cycle progression [4]. One of the significant mechanisms thought to mediate the opposite effects against circadian misalignment is generalized disruption of the endocrine system [54]. TSH and thyroid hormones display seasonal variations in the blood.

TNFα interferes with circadian clock control and induces extended rest periods in the dark by suppressing the expression of PER genes through activating p38 MAPK. This process is associated with the development of autoimmune diseases [55].

SIRT1 binds to CLOCK and is introduced by circadian gene promoters to the CLOCK: BMAL1 complex. SIRT1 deacetylates H3K9 and H3K14 at these sites, as well as the BMAL1 and PER2 non-histone proteins. Inhibition or deletion of SIRT1 leads to changes in the circadian cycle [56], as shown by reducing the expression of PER2 and BMAL1 genes in the current study.

The present study also revealed that the levels of peripheral leucocytes NF-κB and TLR-4 gene expression were significantly upregulated in the HT group compared to control group. Different Studies found high serum concentrations of Hsp60 and HMGB1 (Ligands of TLR-4) in HT patients compared to healthy controls. Ligand binding to TLR-4 leads to activation of TLR-4 MyD88-dependent pathway [57.58]. These previous studies suggested a positive correlation between HSP60 and autoantibodies TPO-Abs and Tg-Abs in HT patients.

The NF-κB activation occurs via cell membrane receptors like TLR-4 that can induce cell proliferation, inflammatory response, and immune system cell recruitment for cancer progression [59].

Faria et al., 2020, It was proposed that the canonical NF-κB pathway may be involved in Sodium Iodide Symporter downregulation. NF-κB provides a mechanism by which immune activation can lead to dysregulation of the circadian rhythm. NF-κB involved in the regulation of circadian rhythms in cells by alteration of clock repressor limb, leading to disruption of clock cycles and alteration of circadian rhythm in mice [60, 61]. NF-κB can also relocalize the CLOCK/BMAL-1 at new sites in the genome close to sites bound by NF-κB, to regulate transcription following inflammatory stimuli [61].

In mammals, NF-κB can alter the circadian clock by interaction with BMAL-1 protein and by modification of circadian rhythms in the SCN activity. Shen et al., 2020, RELA, like CRY1, has been found to be able to suppress BMAL1/operation CLOCK's at the circadian E-box cis-element and compete with coactivator CBP/p300 to bid for BMAL1/CLOCK. ChIP technique revealed that RELA and BMAL1-CLOCK binding sites collect on the E-box elements of circadian genes. These findings supported the vital function of NF-κB in control of the circadian system and the connection between inflammation and circadian pathways [62].

Melatonin is produced predominantly from the pineal gland. The hormone that was first structurally recognized in 1958 is a circadian rhythm-dependently synthesized and released hormone [63]. Melatonin decreased in serum of HT patient. In the pineal gland, NF-κB activation through TLR-4 (LPS), leads to translocation of p50/p50 and p50/ReIA dimers into the nucleus. Nuclear transport of these dimers decreases noradrenaline induced AA-NAT mRNA transcription, leading to reduced melatonin synthesis. The BMAL-1 circadian clock protein plays a key role in circadian rhythms and regulates the regular rhythms of melatonin [64].

The NAT gene is the rate-limiting enzyme used in the synthesis of L-tryptophan melatonin. Via the E-box in its promoter, BMAL/CLOCK heterodimers also transactivate Nat gene transcription. NAT, the key enzyme in melatonin synthesis [65]. The present study showed that PER2 expression was directly correlated with anti-Tg-Ab level (r = 0.435, p = 0.016, Fig. 9c) and melatonin concentration (r=-0.506, p = 0.004, Fig. 9d).

The expression of the p65 subunit can be suppressed by melatonin and the inhibitory IkB protein expression can be increased. It can also inhibit the expression of TLR-4 and decrease the levels of MyD88 protein in the cytosol, thus blocking induction of NF-κB [66]. Melatonin can also prevent the phosphorylation of IkB by IKK, which prevents the activation of NF-κB and its binding to multiple genes in the promoter region [67].

From this study, we can conclude that there is an association between Hashimoto thyroiditis and circadian rhythms approved by downregulation of Bmal-1 and PER2 genes expression Also, it may leads to an inflammatory response and oxidative stress. The significant decrease of serum melatonin levels in HT patients, strongly suggests an association between the melatonin pathway and HT. So, Melatonin may be recommended as supplementation for HT patients. Further studies on the circadian genes and circadian rhythm in HT are required.

Author’s contribution:

Sara.A.Shaker: Supervise the practical part. Data analysis and interpretation. Writing of the manuscript.Magda A. Meghad: Propose research plan, Review of manuscript and accepted it. Analyze and interpreted the result. Mahmoud Mahfouz: Perform practical work, review and accept manuscript.Tamer E. Hassanien: Perform practical work, review and accept manuscript.Bothina F Mahmoud: Supervise the practical part and analyze the results and interpretation. Review of the manuscript and accepted it. Tarek M. Salem: Concept and design, Recruiting patients, Acquisition of data, Data analysis and interpretation, Critical revision of the manuscript.

There are no conflicts to declare.

Conflict of interest:

There was no conflict of interest

Ethical Approval:

Approval is taken by Medical Research Institute Ethical Committee, University of Alexandria, The research was performed for studies involving humans according to the World Medical Association's Code of Ethics (Declaration of Helsinki).

Informed Consent:

All the participant in the study signed the consent before participating in the research.

Mincer DL, Jialal I. Hashimoto Thyroiditis. Treasure Island (FL): StatPearls. 2020 Aug PMID: 29083758.
Pyzik A, Grywalska E, Matyjaszek-Matuszek B, Roliński J."Immune disorders in Hashimoto's thyroiditis: what do we know so far?".J Immunol Res. 2015 Apr;2015(1):1-8
Reddy S, Reddy V, Sharma S. Physiology, Circadian Rhythm. Treasure Island (FL): StatPearls Publishing; 2020 Jan-. Available from:https://www.ncbi.nlm.nih.gov/books/NBK519507
Ikegami K, Refetoff S, Cauter E, Yoshimura T. Interconnection between circadian clocks and thyroid function. Nat Rev Endocrino. 2019 Oct;15(10): 590–600.
SawantOB, Horton AM, Zucaro OF, Chan R, Boniha VL, Samules IS, et al . The Circadian Clock Gene Bmal1 Controls Thyroid Hormone-Mediated Spectral Identity and Cone Photoreceptor Function. Cell rep. 2017 Oct; 21(3), 692-706
Lin, JD, Fang, WF, Tang, KT, Cheng CW. Effects of exogenous melatonin on clinical and pathological features of a human thyroglobulin-induced experimental autoimmune thyroiditis mouse model. Sci Rep. 2019 Apr; 9,5886.
Cernysiov, V, Gerasimcik N, Mauricas M, Girkontaite I. Regulation of T-cell-independent and T-cell-dependent antibody production by circadian rhythm and melatonin. Int Immunol 2010 Jan; 22: 25–34.
Lin GJ, Huang SH, Chen SJ, Wang CH, Chang DM, Sytwu HK. Modulation by melatonin of the pathogenesis of inflammatory autoimmune diseases. Int J Mol Sci. 2013 May;14(6):11742-66.
Botelho IMB,Moura Neto A,Silva CA,Tambascia MA,Alegre SM,Zantut-Wittmann DE. Vitamin D in Hashimoto's thyroiditis and its relationship with thyroid function and inflammatory status.Endocr J. 2018 Oct;29; 65(10):1029-37.
Qu H,Lin K,Wang H, Wei H, Ji B, Yang Z, et al. 1,25(OH)2 D3 improves cardiac dysfunction, hypertrophy, and fibrosis through PARP1/SIRT1/mTOR-related mechanisms in type 1 diabetes.Mol Nutr Food Res. 2017 may;61(5). DOI:10.1002/mnfr.201600338.
Chang HC, Guarente L. SIRT1 and other sirtuins in metabolism. Trends Endocrinol Metab. 2014 Dec;25:138–45.
Simmons GE, Pruitt WM, Pruitt K. Diverse roles of SIRT1 in cancer biology and lipid metabolism. Int J Mol Sci. 2015 Jan;16:950–65.
An B-S, Tavera-Mendoza LE, Dimitrov V, Wang X, Calderon MR, Wang H, et al. Stimulation of Sirt1-regulated FoxO protein function by the ligand-bound vitamin D receptor. Mol Cell Biol. 2010 Oct; 30:4890–900.
Nakahata Y, Kaluzova M, Grimaldi B, Sahar S, Hirayama J, Chen D, et al. The NAD+-dependent deacetylase SIRT1 modulates CLOCK-mediated chromatin remodeling and circadian control. Cell. 2008 Jul; 134:329–40.
Nakahata Y, Sahar S, Astarita G, Kaluzova M, Sassone-Corsi P. Circadian control of the NAD+ salvage pathway by CLOCK-SIRT1. Science. 2009 May; 324:654–7.
Ajibade AA, Wang HY, Wang R.F. Cell type-specific function of TAK1 in innate immune signaling. Trends in Immunology, 2013 Jul;34:307-16.
GiulianiC, Bucci I, Napolitano G. The Role of the Transcription Factor Nuclear Factor-kappa B in Thyroid Autoimmunity and Cancer. Front Endocrinol. 2018 Aug; 9: 471.
Reale C, Zotti, T, Scudiero I, Vito P, Stilo R. The NF-κB family of transcription factors and its role in thyroid physiology. Vitam & Horm. 2018 Sep;106:195-210.
Sarkar R. TSH Comparison, Between chemiluminescence (architect) and electrochemiluminescence (Cobas) immunoassays: an Indian population perspective. Ind J Clin Biochem.2014 Apr;29 (2):189-95.
Kazerouni F, Amirrasouli H. Performance characteristics of three automated immunoassays for thyroid hormones. Casp J Intern Med. 2012 Spr;3:400-4.
Intan NS, Thambiah S, Hannah P, NorBaizurah B, Baizurah MH. Performance characteristics of antithyroid peroxidase and antithyroglobulin assays on Roche Cobas E411 immunoassay system. IJPH CS. 2014 Nov;1(2):2289-7577.
Burnett RW, Christiansen TF, Covington AK, Fogh-Andreson N,Külpmann WR,Lewenstam A, et al. International Federation of Clinical Chemistry and Laboratory Medicine. IFCC Scientific Division, Working Group on Selective Electrodes. IFCC recommended a reference method for the determination of the substance concentration of ionized calcium in undiluted serum, plasma, or whole blood. CCLM. 2000 Jan; 38(12):1301-14.
Grillone R, Grimaldi E, Scopacasa F, Dente B. Evaluation of the fully automated hematological analyzer Mindray BC 6800: comparison with Horiba ABX Pentra DX120. Int JLabHematol. 2014 Nov;36: e55–e8.
Milon A, Pawlicki, P, Rak A, Mlyczynska E, Płachno BJ, Tworzydlo W, et al. Telocytes are localized to the testis of the bank vole (Myodes glareolus) and are affected by lighting conditions and G-coupled membrane estrogen receptor (GPER) signaling. GenComp Endocrinol. 2019 Jan; 15(271):39-48.
Saida FB,Padilla-Chee M,Dou C,Yuan C. First two-reagent vitamin D assay for general clinical chemistry.Clin Biochem. 2018 May;55:28-35.
Reszka E, Peplonska B, Wieczorek E, Sobala W, Bukowska A, Gromadzinska J, et al. Circadian gene expression in peripheral blood leukocytes of rotating night shift nurses. Scand J of WorkEnvironHealth. 2013 Mar;39(2):187-94.
Kandalepas PC,Mitchell JW,Gillette MU. Melatonin Signal Transduction Pathways Require E-Box-Mediated Transcription of Per1 and Per2 to Reset the SCN Clock at Dusk.PLoS One. 2016 Jun; 11(6):e0157824.
Martínez V,Mitjans M,Vinardell MP. TNF alpha measurement in rat and human whole blood as an in vitro method to assay pyrogens and its inhibition by dexamethasone and erythromycin.J Pharm Sci. 2004 Nov;93(11):2718-23.
Yoshimura K, Matsuu A, Sasaki K, Momoi Y. Detection of Sirtuin-1 protein expression in peripheral blood leukocytes in dogs.J Vet Med Sci. 2018 Jul; 80(7):1068–76.
Oeckinghaus A, Ghosh S.The NF-κB family of transcription factors and its regulation. Cold Spring Harb Perspect Biol. 2009 Oct;1(4): a000034
Vaure C, Liu Y. A comparative review of toll-like receptor 4 expressions and functionality in different animal species. Front Immunol. 2014 Jul;5, 316.
Hagen A. Multi-Method Assessment of Map Similarity. In: Ruiz, M., Gould, M., and Ramon, J., Eds., Proceedings of the 5th AGILE Conference on Geographic Information Science, European Commission, Palma. 2002;171-182.
Barić A,Brčić L,Gračan S,Skrabic V. Thyroglobulin Antibodies are Associated with Symptom Burden in Patients with Hashimoto’s Thyroiditis: A Cross-Sectional Study.Immunol Invest. 2019 Feb,48(10):198-209.
Tipu H N, Ahmed D, Bashir M M, Asif N. Significance of Testing Anti-Thyroid Autoantibodies in Patients with Deranged Thyroid Profile. JThyroid Res. 2018 Apr,doi: 10.1155/2018/9610497.
Fröhlich E, Wahl R. Thyroid Autoimmunity: Role of Anti-thyroid Antibodies in Thyroid and Extra-Thyroidal Diseases. Front Immunol. 2017 May;8:521. doi: 10.3389/fimmu.2017.00521.
McLachlan SM, Rapoport B. Why measure thyroglobulin autoantibodies rather than thyroid peroxidase autoantibodies?. Thyroid: Official Journal of the American Thyroid Association. 2004 Jul;14(7):510-20.
Ahmed S S, Mohammed A A. Effects of thyroid dysfunction on hematological parameters: Case controlled study. Annal med &surg.2020 Jul;57:52–5.
Szczepanek-ParulskaE, Hernik A. Ruchala M. Anemia in thyroid diseases.
Pol Arch Intern Med. 2017Mar;127:352–60.
KhatiwadaS, GelalB, BaralN, LamsalM. Association between iron status and thyroid function in Nepalese children. Thyroid Res. 2016 Jan;27: 9:2.doi: 10.1186/s13044-016-0031-0.
Dorgalaleh A, Mahmoodi M, Varmaghani B, KianiNode F, Saeeidi Kia O, Alizadeh Sh, et al. Effect of thyroid dysfunctions on blood cell count and red blood cell indice. Pediatr HematolOncolJ. 2013 Apr;3(2):73-7.
M'Rabet-Bensalah K, Aubert CE, Coslovsky M,Collet TH, Baumgartner C, den Elzen WP, et al. Thyroid dysfunction and anaemia in a large population-based study. Clin Endocrino (Oxf). 2016 Apr; 84(4): 627-31.
Shivaleela MB, Poornima RT, Jayaprakash, Murthy DS. Serum calcium and phosphorous levels in thyroid dysfunction. Ind J Fund Appl Life Sci. 2012;2(2):179-183.
GohelMG, Shah AM, Shah AM, Makadia JS. A study of serum calcium, magnesium, and phosphorus level in hypothyroidism patients.IJMRHS. 2014Aug;3(4):308-12.
Abdel-Gayoum AA. Dyslipidemia and serum mineral profiles in patients with thyroid disorders. Saudi Medi Jo. 2014 Aug;35(12):1469-76.
Ashmaik AS, Gabra .M, Elzein AO, Nassr Eldin MA, Hassan E. Assessment of serum levels of calcium and phosphorous in sudanese patients with hypothyroidism. Asian J Biomed Pharmaceut Sci. 2013;3(25): 21-6.
Mani V, Natarajan MSS, Mohanakrishnan VV. Comparison of total and ionic calcium in hypothyroidism. J Clin Diagn Res. 2019; May13(5): BC10-BC2.
Ahi S, Dehdar MR., Hatami N. Vitamin D deficiency in non-autoimmune hypothyroidism: a case-control study. BMC Endocr disor. 20020 Aug; 20(1), 41.
Liontiris M I, Mazokopakis E E. A concise review of Hashimoto thyroiditis (HT) and the importance of iodine, selenium, vitamin D and gluten on the autoimmunity and dietary management of HT patients.Points that need more investigation. Hellenic J Nucl Med. 2017 Mar;20(1), 51–6.
Ohmori M, Harii N, Endo T, Onaya T. Tumor Necrosis Factor-α Regulation of Thyroid Transcription Factor-1 and Pax-8 in Rat Thyroid FRTL-5 Cells. Endocrinolo. 1999 Oct; 140(10): 4651–8.
Al-Khaldi A, Sultan S. The expression of sirtuins, superoxide dismutase, and lipid peroxidation status in peripheral blood from patients with diabetes and hypothyroidism. BMC Endocr Disord. 2019 Feb; 19(1):19. doi: 10.1186/s12902-019-0350-y.
Copinschi G, Challet E. Endocrine Rhythms, the Sleep-Wake Cycle, and Biological Clocks. Endocrinology: Adult and Pediatric. 2016 Mar;147–173
Noguchi T, Ikeda M, Ohmiya Y, Nakajima Y. A dual-color luciferase assay system reveals circadian resetting of cultured fibroblasts by co-cultured adrenal glands. PLOS ONE. 2017 May;7,doi.:/10.1371/.0037093.
Peliciari- Garcia R A, Bargi- Souza P, Young M E, Nunes M T. Repercussions of hypo and hyperthyroidism on the heart circadian clock. Chronobiol Inter. 2018 Feb;35:147-159.
Kettner N. M, Katchy C A, Fu L. Circadian gene variants in cancer. Ann Med. 2014 Jun; 46:208–20.
Ertosun M G, Kocak G, Ozes O N. The regulation of circadian clock by tumor necrosis factor alpha. Cytokine & growth factor rev. 2019 Apr; 46:10–6.
Nakahata Y, Kaluzova M, Grimaldi B, Sahar S, Hirayama J, Chen D, et al.The NAD+-dependent deacetylase SIRT1 modulates CLOCK-mediated chromatin remodeling and circadian control. Cell. 2008 Jul;134(2), 329–40.
Peng S, Li C, Wang X, Liu X, Han C, Jin T, et al.Increased Toll-Like Receptors Activity and TLR Ligands in Patients with Autoimmune Thyroid Diseases. Front Immunol. 2016 Dec;7:578.
Mardente S, Zicari A, Consorti F, Mari E, Di Vito M, Leopizzi M, et al. Cross-talk between NO and HMGB1 in lymphocytic thyroiditis and papillary thyroid cancer. Oncoloy Rep. 2010 Dec;24(6):1455-61.
Chuffa LG, Alves MS, Martinez M, Camargo IC, Pinheiro PF, Domeniconi RF, et al. Apoptosis is triggered by melatonin in an in vivo model of ovarian carcinoma. Endocr Relat Cancer. 2016 Feb;23:65-76
Faria M, Domingues R, Paixão F, Bugalho MJ, Matos P, Silva AL. TNFα-mediated activation of NF-κB downregulates sodium-iodide symporter expression in thyroid cells. PLoS ONE. 2020 Feb;15(2): e0228794
Hong H-K, Maury E, Ramsey K M, Perelis M, Marcheva B, Omura C, et al. The requirement for NF-κB in the maintenance of molecular and behavioral circadian rhythms in mice. Genes Dev. 2018 Nov;32:1367–79.
62. Shen Y, Wang W, Endale M.,Francey LJ, Harold RL, Hammers DW, et al. NF-κB modifies the mammalian circadian clock through interaction with the core clock protein BMAL1. bioRxiv preprint doi: https://doi.org/10.1101/2020.09.06.285254; this version was posted September 6, 2020.
63. Tan DX, Manchester LC, Sanchez-Barcelo E, Mediavilla MD, Reiter R.J. Significance of high levels of endogenous melatonin in mammalian cerebrospinal fluid and the central nervous system. Curr Neuropharmacol. 2010 Sep;8:162-167.
64.Vriend J, Reiter R.J. Melatonin feedback on clock genes: a theory involving the proteasome. J Pineal Res. 2015 Jan;58: 1-11.
65. Chen W, Baler R. The rat arylalkylamine N-acetyltransferase E-box: differential use in a master vs. a slave oscillator. Molecular Brain Res. 2000 Sep;81: 43–50
66. Hu ZP, Fang XL, Fang N, Wang XB, Qian HY, Cao Z, et al. Melatonin ameliorates vascular endothelial dysfunction, inflammation, and atherosclerosis by suppressing the TLR4/NF-kB system in high-fat-fed rabbits. J Pineal Res. 2013 Nov;55, 388-98
67.Ordoñez R, Carbajo-Pescador S, Prieto-Dominguez N, García-Palomo A, González-Gallego, J, Mauriz JL. Inhinition of matrix metalloproteinase-9 and nuclear factor kappa contribute to mela-tonin prevention of motility and invasiveness in HepG2 liver can-cer cells. J Pineal Res. 2014 Jan;56: 20-30..

No competing interests reported.

Thyroid –pineal axis: Melatonin, circadian clock genes expression and vitamin D in Hashimoto's thyroiditis patients

Status:

Version 1

Abstract

Objective

Results

Conclusions

Figures

1. Introduction

2. Subjects And Methods

2.1 Participants

2.2 Methods:

2.2.1 Determination of serum TSH [19], FT₃, FT₄ [20] levels.

2.2.2 Determination of serum anti TPO-Abs and anti Tg-Abs levels [21].

2.2.3 Determination of serum ionized calcium (Ca^+ 2) [22].

2.2.4 Determination of blood hemoglobin concentration (Hb) [23].

2.2.5 Determination of serum melatonin [24].

2.2.6 Determination of serum vitamin D [25].

2.2.10 Statistical Analysis

3. Results

3.1 Thyroid function tests

3.2 Anti TPO-Abs and anti Tg-Abs

3.3 Ionized Calcium and Hemoglobin Concentrations

3.4 Serum Vitamin D

3.5 Serum Melatonin (pg/ml)

3.6 Gene expression of BMAL1, PER2, SIRT1 (fold change)

3.7 Gene expression of TNFα, NF-κB, TLR4 (Fold change)

3.8 Correlation studies:

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Status:

Version 1

Thyroid –pineal axis: Melatonin, circadian clock genes expression and vitamin D in Hashimoto's thyroiditis patients

Status:

Version 1

Abstract

Objective

Results

Conclusions

Figures

1. Introduction

2. Subjects And Methods

2.1 Participants

2.2 Methods:

2.2.1 Determination of serum TSH [19], FT3, FT4 [20] levels.

2.2.2 Determination of serum anti TPO-Abs and anti Tg-Abs levels [21].

2.2.3 Determination of serum ionized calcium (Ca+ 2) [22].

2.2.4 Determination of blood hemoglobin concentration (Hb) [23].

2.2.5 Determination of serum melatonin [24].

2.2.6 Determination of serum vitamin D [25].

2.2.10 Statistical Analysis

3. Results

3.1 Thyroid function tests

3.2 Anti TPO-Abs and anti Tg-Abs

3.3 Ionized Calcium and Hemoglobin Concentrations

3.4 Serum Vitamin D

3.5 Serum Melatonin (pg/ml)

3.6 Gene expression of BMAL1, PER2, SIRT1 (fold change)

3.7 Gene expression of TNFα, NF-κB, TLR4 (Fold change)

3.8 Correlation studies:

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Status:

Version 1

2.2.1 Determination of serum TSH [19], FT₃, FT₄ [20] levels.

2.2.3 Determination of serum ionized calcium (Ca^+ 2) [22].