Participants
Overall, 103 patients with KOA, diagnosed according to criteria set by the American College of Rheumatology, were recruited from May 2017 to June 2018 at the Orthopedics Department of the first hospital of Jilin University. After a 12 h fast, venous blood and SF samples were collected from patients and 86 healthy volunteers at their annual examinations conducted at our Health Evaluation Center of the first hospital of Jilin University. All collected blood and synovial fluid samples were centrifuged at 3000g for ten minutes at 4 °C. The supernatants of blood and synovial fluid were aliquoted and stored at -80 °C until assay. Clinical data of KOA patients was reviewed to exclude patients treated with intraarticular glucocorticoid or hyaluronic acid injections within 6 months. This study was approved by the Ethics Committee of the first hospital of Jilin University (reference no: 2017-429). All participants provided signed informed consent, and the study was performed in accordance with the Declaration of Helsinki. All data pertaining to study participants are presented in Table I.
Collection of human cartilage samples
Samples of KOA cartilage were obtained from primary total knee replacement (TKA) surgery patients. Samples of control cartilage were collected from patients with femoral neck fracture (FNF) within 12h of injury, and articular cartilage of femoral heads were macroscopically intact and showed little degeneration regardless of age (Collins score 0), as evaluated at the Orthopedics Department of the first hospital of Jilin University. Collection of all cartilage samples had the approval of the permission of the patients according to the Declaration of Helsinki. All sample details are listed in Table Ⅱ.
Isolation and culture of human chondrocytes
Nine cartilage tissue samples were harvested randomly from patients with KOA (N=21) and divided into three groups randomly. Three cartilage tissue samples of each group were pooled prior to cell isolation and culture. Chondrocytes were isolated as previously described[31] and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM)/F12 supplemented with 10% foetal bovine serum (FBS) and 1% penicillin/streptomycin in a CO2 incubator at 37 °C. Then, (DMEM)/F12 media were replaced with serum-free media, and chondrocytes were starved 12 h before treatment with resistin at different concentrations and time-points. Chondrocytes at passage one and two were used in our study.
Enzyme-linked immunosorbent assay (ELISA)
Concentration of resistin in samples of serum and SF was quantitated using ELISA kits (CUSABIO, China; CSB-E06884h) according to manufacturer’s instructions. The range of detection was 0.312–20 ng/mL.
Immunohistochemical assessment of cartilage tissues
A total 10 control cartilage samples from patients with FNF and 21 KOA cartilage samples were used to evaluate the expression of resistin and CAP1 via IHC. Specimens were embedded in paraffin and sectioned at 3 μm. Each section was rehydrated in ethanol (100, 90, and 80%) for 5 minutes, respectively, heated at 95°C for 10 minutes in 10 mM sodium citrate buffer solution (pH 6.0) for antigen recovery, and then treated with 3% (v/v) H2O2 for 15 min to block endogenous peroxidase activity. After several washes with PBS, sections were incubated with serum-free protein block (Agilent Technologies) for 30 min to block non-specific binding. Sections were then incubated at 4°C overnight with mouse anti-resistin monoclonal antibody (concentration at 10 μg/ml, ab136877; Abcam), rabbit anti-CAP1 monoclonal antibody (diluted at 1:200, EPR8339B; Abcam), or isotype control (Agilent Technologies). Expression level was detected using a Mouse and Rabbit Specific HRP/AEC (ABC) Detection IHC Kit (Abcam), after which the sections were counterstained with hematoxylin.
An H-Score was calculated for each case using the formula: H-Score = P × I, where percentage (P) of positively stained cells (0–100) was multiplied by staining intensity (I) score (0, negative; 1, weak; 2, moderate; 3, strong staining). The H-Scores ranged from 0 to 300. Expression of CAP1 and resistin was analysed based on H-Score using ASI digital systems (powered by GenASIs™, GenASIs Client:8.1.0.47741, Israel).
Stimulatory effects of resistin on chondrocytes
Chondrocytes were seeded in 6-well plates at 1×104 cells/cm2 and cultured as described above. Then, chondrocytes were incubated for 0, 24, 48, or 72 hours in DMEM/F12 containing human recombinant resistin (500 ng/mL) (PeproTech, USA) with 1% FBS to evaluate time-response effects, or with resistin (0, 250, 500, or 1000 ng/mL) for 48 hours to evaluate dose-response effects or 24, 48 and 72 hours to evaluate CPA1 expression. Resistin-induced mRNA expression of CCL3, CCL4, MMP13, ADAMTS-4 and CAP1 was evaluated by qRT-PCR.
Co-immunoprecipitation assays (Co-IP)
Chondrocytes were cultured in 6-well plates (at 2 × 105 cells/well) as described previously with and without resistin (at 500 ng/ml) for 48 h. Cells were then washed with ice-cold phosphate buffered saline (PBS), and protein was harvested using a cell lysis buffer (Beyotime, China). CAP1 co-immunoprecipitation was performed using a Pierce™ Co-Immunoprecipitation Kit (Thermo Scientific) according to manufacturer's instructions. For immunoprecipitation, cell lysates were incubated overnight on ice with CAP1 antibody labelled beads to examine binding of resistin and CAP1. Rabbit IgG was used as negative control. After overnight incubation, the eluted protein was detected by western blotting using an antibody against resistin (Abcam, 1:1000).
Knockdown of CAP1 via adenovirus (Adv)-mediated transfection in chondrocytes
A recombinant Adv vector was generated by cloning shRNA fragments into an Adv vector GV119 (Shanghai Genechem Co., Ltd, China) via enzymatic digestion and ligation. Three shRNA sequences were designed to silence the expression of CAP1 in human chondrocytes in vitro. One of the CAP1-shRNA-targeting sequences was 5′- CCTGGCCCTTATGTGAAAGAA -3′, whereas the negative control shRNA sequence was 5′-TTCTCCGAACGTGTCACGT-3′.
Chondrocytes were transfected with CAP1-shRNA or control-shRNA for 48 h, and treated with resistin (500 ng/mL) for another 48 and 72 h. All experiments were performed at a multiplicity of infection (MOI) of 40 plaque forming units (PFU). The efficiency of CAP1 knockdown was confirmed by qRT-PCR and western blotting. Expression of CCL3, CCL4, MMP13, and ADAMTS-4 mRNA was assessed via qRT-PCR. The level of secreted proteins in culture supernatants was determined using ELISA (RayBiotech, USA) according to manufacturer’s instructions.
Total RNA extraction and quantitative real-time PCR
Total RNA was extracted from chondrocytes and human cartilage and reverse-transcribed into cDNA. The qRT-PCR was conducted as described previously[32]. Primers used for qRT-PCR are shown in Supplementary materials I. The Ct values for target genes were calculated as described previously[22].
Western blot analysis
Preparations for western blotting, and procedures involved in sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) were performed as described previously[32]. The following antibodies were used: anti-CAP1 (ab155079, 1:4000), anti-p65 (ab32536, 1:10000), antiphospho-p65 (ab76302, 1:15000), anti-p38 (ab170099, 1:3000), anti-phospho-p38 (ab195049, 1:1000), anti-β-actin (ab8226, 1:4000), anti-GAPDH (#5174, CST, 1:10000), goat anti-rabbit IgG (ab6721, 1:10000), and goat anti-mouse IgG (ab205719, 1:4000).
Signalling pathway of resistin via CAP1
Chondrocytes were seeded into 6-well plates (at 2×105 cells /well), cultured for 24 h, as described previously, and incubated with resistin (500 ng/mL) for 30 min, 60 min, 6 h, or 24 h. Chondrocytes incubated without resistin were used as a control group. The four groups of chondrocytes were as follows: Group 1/Group 2, transfected with CAP1-shRNA and incubated without/with resistin (500 ng/mL, 24 h); Group 3/Group 4, transfected with Control-shRNA and incubated without/with resistin (500 ng/mL, 24 h), were designed to detect resistin-CAP1 signalling pathways. Western blotting was used to examine the expression of proteins in the NF-κB (p65 and phospho-p65) and p38-MAPK (p38 and phospho-p38) pathways.
Statistical analysis
Results are presented as mean ± standard deviation. Independent t-test and Wilcoxon Rank Sum test were used to compare values of KOA and HC groups. Levels of serum resistin in the two groups were evaluated by analysis of covariance after adjustment for age, body mass index (BMI), fasting blood glucose levels (FBG), and triglyceride levels (TG). Pearson correlation coefficient was used to analyse correlations between resistin and CAP1 expression for all IHC results. Paired t-test was used to compare expression of CCL3, CCL4, MMP13, and ADAMTS-4 between control-shRNA and CAP1-shRNA groups. For testing differences among more than two groups, one-way ANOVA was first used to test the overall difference and followed by Bonferroni post-hoc test in various subgroups. p < 0.05 was considered statistically significant, and all statistical analyses were performed using SPSS 22.0 (IBM).