Locations, Plasmodium vivax samples collection and DNA purification
In general, 50, 15, and 15 P. vivax microscopically confirmed cases were collected from the patients that were referred to malaria diagnostics centres in Laghman (34° North, 70° East), Baghlan (36° North and 68° East) and Khost (33° North and 70° East) provinces (Fig. 1), respectively, during 2017. For this, finger stick blood samples were spotted on DNA Banking Cards (DBCs) (Kowsar Biotechnology Center, Tehran, Iran) and microscope slides.
DNA extraction and Plasmodium vivax confirmation
Disks (2 mm in diameter) were punched out from each DBCs and washed 3 times with DBCs purification buffer and twice with distilled water. The disks were air dried and used directly as template of PCR processing [29]. A semi-nested multiplex PCR were performed on each sample for final confirmation of P. vivax [30].
Evaluation of pvmdr1 mutations by nested-PCR
Briefly, in first round pvmdr-1 (OF) and pvmdr-1 (OR) primers, were applied for amplification of about 967 bp fragment of pvmdr-1 gene of P. vivax. Three punched discs were used for each PCR reaction of the first round. One microlitre of all products of the first round diluted into 500 μl of sterile water. In the second round 1 μl of pvmdr-1 (NF) and pvmdr-1 (NR) primers and 2 μl of diluted product of the first round were added into 25 μl of “2X Taq Master Mix Red” (Amplicon inc., containing 150 mMTris-Cl pH 8.5, 40 mM (nh4) 2So4, 3 mM Mgcl2, 0.2% tween 20, 0.4 mM dntPs, 0.05 U/µl Taq DNA polymerase, inert red dye and stabilizer), to reach a final concentration of 50μl. The first round was done in 94°C, 5 min; 30 cycles of 94°C, 15 Sec; 60°C, 30 Sec; 72°C, 1 min; 72°C, 7 min, while the second round PCR was done under the following conditions: 94°C, 5 min; 30 cycles of 94°C, 15 Sec; 57°C, 30 Sec; 72°C, 1 min; 72°C, 7 min. The products of the second round (604 bp) were seen in 2% agarose gels (SYBR Safe stain; Invitrogen; Groningen, The Netherlands). The pvmdr-1 (NF) and PCR products were sent for sequencing by the ABI3730XL sequence analyzer (Macrogen, Korea) [8].
Evaluation of pvcrt-o K10 insertion by semi-nested PCR
Briefly in first round pvcrt-o (OF) and pvcrt-o (OR) primers, were applied for amplification of about 1186 bp fragment of pvcrt-o gene of P. vivax. Three punched discs were used for each PCR reaction of the first round. One microlitre of all products of the first round diluted into 500 μl of sterile water. In the second round the 1 μl of pvcrt-o(OF) and pvcrt-o (Rseq) primers and 2 μl of diluted product of first round were added into 25 microlitre of “2X Taq Master Mix Red” (Amplicon Inc.), to reach a final concentration of 50 μl. The first round was done in 95°C, 5 min; 30 cycles of 94°C, 15 Sec; 52°C, 30 Sec; 72°C, 90sec; 72°C, 7 min, while the second round PCR was done under the following conditions: 94°C, 5 min; 30 cycles of 94°C, 15 Sec; 55°C, 30 Sec; 72°C, 30 Sec; 72°C, 7 min. The products of the second round (296 bp) were seen in 2% agarose gels (SYBR Safe stain; Invitrogen; Groningen, The Netherlands). The Pvcrt-o(OF) and PCR products were sent for sequencing by the ABI3730XL sequence analyzer (Macrogen, Korea) [8, 31].
Table 1. Primers used for amplifications of pvcrt-o and pvmdr-1 marker genes: OF (Outer forward), OR (outer reverse), NF (nested forward), NR (nested reverse).
Primers
|
Sequences 5′ → 3′
|
Final Size (bp)
|
Annealing temp. (°C)
|
Pvmdr-1 (OF)
|
CGCCATTATAGCCCTGAGCA
|
604
|
60
|
Pvmdr-1 (OR)
|
TCTCACGTCGATGAGGGACT
|
|
Pvmdr-1 (NF)
|
GGATAGTCATGCCCCAGGATTG
|
57
|
Pvmdr-1 (NR)
|
CATCAACTTCCCGGCGTAGC
|
|
Pvcrt-o F
|
AAGAGCCGTCTAGCCATCC
|
296
|
52
|
Pvcrt-o R
|
AGTTTCCCTCTACACCCG
|
|
Pvcrt-o (Rseq)
|
GGGGACGTCCTCTTGTATTT
|
55
|
Development of asymmetric real time PCR and melt-curve analysis
Primer and probe design
The genomic sequence of P vivax (accession number: EU33972) was imported into CLC Main Workbench 5 (CLC bio, Aarhus, Denmark) Software. The Pvcrto-OF primer was selected as forward primer [8] and a reverse primer was designed for pvcrt-o gene. Then a probe designed that contain the insertion of interest. The probe blocking improved by amino-modified C6 to prevent extension during PCR amplification. The primers, probe sequences, and their position in the pvcrt-o gene are presented in Table 2 and Fig. 2.
Table 2 High-resolution melting assay primer and probe sequences used for detection K10 insertion in pvcrt-o gene.
Name
|
Primer/ probe
|
Sequence 5′ → 3′
|
TM
|
Products size
|
Wild
|
Mutant
|
Pvcrto-O F
|
Forward primer
|
GCTACCCCTAACGCACAATG
|
60
|
80
|
83
|
Afg.HRM. R
|
Reverse primer
|
CCGGTAACGTTCATCGG
|
Afg.U.P
|
Unlabelled Probe
|
CTGAAAAAGAAGAAGAAGAAGGG- block
|
Amplification conditions
The qPCR-HRM assay was performed using an ABI 7500 Fast Real-time PCR system (Applied Biosystems, Inc.). The PCR was set up in a final volume of 20 µl containing 0.1 μM of Pvcrt0-OF (forward primer), 0.5 μM Afg.HRM. R (the reverse primer and the excess primer) and 0.5 μM Afg.U.P probe, 2 µl of diluted product of first round from semi nested PCR and 4 µl of 5X Hot Firepol® EvaGreen® HRM Mix (Solis BioDyne, Tartu, Estonia) in qPCR 8-strip tubes (Gunster Biotech, Taiwan).
The thermal program included an initial denaturation at 95 °C for 12 minutes, followed by 40 cycles of amplification consisting of 95 °C for 15 sec (denaturation step), 60 °C for 20 sec (primer annealing), and 72 °C for 20 sec (elongation step). The amplicons were then subject to a melt program for dissociate the double stranded DNA at 95 °C for 15 seconds, gradual temperature for HRM increase from 55 °C for 1 minute until 95 °C for 15 sec at a thermal transition rate of 0.3%. Ultimately, obtained melting curve profiles were analysed by making use of HRM software for Windows® version 3.0.1. (Applied Biosystems).