Plant materials
D. caryophyllus ‘Hongniang’ served as the plant material. The seeds were provided by Jiangxi Key Laboratory of Plant Resources, sowed in pots, covered with about 2 cm of soil, and germinated in an artificial climate chamber at 25 ℃. One week after germination, the culture conditions were 28 ℃ with 14 hours of light and 22 ℃ with 10 hours of darkness. The seedlings were further cultivated to flowering, and the roots, leaves, sepal, petals, stamens, pistils and flower buds of different periods were taken, frozen via liquid nitrogen, and stored in a -70 ℃ refrigerator for future use.
Abiotic stress treatment mainly includes drought, salt, extreme temperatures and heavy metal treatments. Hormone treatment included naphthaleneacetic acid (NAA), 6-benzylaminopurine (6-BA), gibberellic acid (GA) and abscisic acid (ABA) processing. A cold and heat stress was implemented by exposing the carnation to 4 or 42 ℃ for 24 hours. For other treatments, such as salt, drought, heavy metals, and hormone treatment, the seedlings are placed in NaCl, mannitol, CuSO4, CrCl3, ABA, NAA, 6-BA, and GA solution for 24 hours, after that, roots and leaves were sampled, and the solution concentration is 100 mM [26].
Primer Design
12 candidate internal control genes, including TIF5A (translation initiation factor 5A), UBQ10, TIP41 (TIP41-like family protein ), CYP, glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH), elongation factor 1 alpha (EF1α), actin gene (ACT), 18S Ribosome RNA (18S), a tubulin and β-tubulin gene (TUA, TUB), adenosylmethionine decarboxylase gene (SamDC), and protein phosphatase 2A (PP2A) were selected to determine possible reference genes that exhibited stable expression patterns. These 12 genes were selected because they were commonly used internal housekeeping genes, and their sequences were available in NCBI. The sequence was downloaded from NCBI and primers for RT-qPCR were selected using Primer3 software (v0.4.0) with annealing temperatures of 57 to 68 ℃, primer lengths of 18–20 bp, and approximately 50% GC content. A 60–200 bp amplicon length is used to ensure sufficient amplification efficiency and reduce the impact of RNA integrity on the quantitation process. The primer sequences, amplicon sizes and melting points of all PCR products are shown in Table 1.
Table 1
RT-qPCR primer sequences and the characteristics of the resulting amplicons obtained from Carnation.
Name | Accession No. | Forward primer (5’–3’) | Reverse primer(5’–3’) | Primer TM(℃) | Product Size(bp) | Product TM(℃) | Efficiency | R2 |
EF1α | FY400608.1 | ACCCCGACAAGATCCCATTT | TGGTCAAGGGCCTCAAGTAG | 59 /59 | 115 | 85 | 1.992 | 0.994 |
TIP41 | FY397769.1 | GACACTCGTATGCATTGCGT | CTCGAACTGATGACGCTTGG | 59/59 | 152 | 84 | 1.987 | 0.996 |
TUB | FY383542.1 | GAGCGTTTGTGACATACCCC | GCCTTACGCCTGAACATAGC | 59/59 | 126 | 83 | 2.021 | 0.997 |
UBQ10 | FY401337.1 | CCATTTGGTGTTGCGTCTCA | TCGCTGCTCTCCACTTCC | 59/59 | 90 | 82 | 1.998 | 0.998 |
CYP | FY390976.1 | TCTACGGCGCGAAATTCAAG | TCACGACGTCCAATCCTTCA | 59/59 | 186 | 83.5 | 2.014 | 0.999 |
TUA | FY387136.1 | TCTACGGCGCGAAATTCAAG | TCACGACGTCCAATCCTTCA | 59/59 | 186 | 82.5 | 1.984 | 0.998 |
GAPDH | FY396181.1 | GGTTTGGCATTGTTGAGGGT | TGCTGCTGGGAATGATGTTG | 58/58 | 132 | 81 | 2.028 | 0.996 |
SamDC | FY400181.1 | AAACCAACTACGACGACCCT | ACGATGCCTTCTCCTTGTCA | 59/59 | 72 | 84.5 | 2.022 | 0.998 |
PP2A | FY383979.1 | TCGAGCAGTTGATGGAGTGT | ACTCTTCAACCAAAACCGCC | 59.03/58.97 | 87 | 83 | 1.988 | 0.995 |
ACT | FY386099.1 | GGACTCTGGTGATGGTGTCA | CAATGTACGCCAGCTTCTCC | 59.02/58.99 | 200 | 83.5 | 2.018 | 0.994 |
TIF5A | AF296081.1 | GGCGGGGAAAGACTTGATTC | AGCTTCTACTTGCCACCACT | 58.90/58.94 | 93 | 82.5 | 1.995 | 0.993 |
18S | FY386615.1 | TACAAAGGGCAGGGACGTAG | AGGCCCGGGTAATCTTTGAA | 59.10/59.00 | 126 | 83.5 | 2.009 | 0.994 |
Total RNA Extraction And cDNA Synthesis
According to the manufacturer's protocol, the total RNA was isolated in samples using the Eastep® Super Total RNA Extraction Kit (TaKaRa, Japan), and the genomic DNA was removed by RNase-free DNase I (TaKaRa, Japan). The purity and integrity of RNA were determined by spectrophotometry and agarose electrophoresis, respectively. cDNA synthesis was carried out according to the PrimeScriptTM RT Reagent Kit with gDNA Eraser [TaKaRa] operating instructions, in the presence of 500 ng RNA, 2.5 M oligo-(dT).
Real-time PCR
RT-qPCR was performed using an CFX Connect™ Real-Time PCR Detection System and a TB Green® Premix Ex TaqTM II Kit. The RT-qPCR reaction was carried out in a 20 uL reaction, including 1.6 µl of cDNA, 0.8 µl of each primer (10 µM), and 10.0 µl of 2 × TB Green Premix Ex Taq II (Tli RNaseH Plus). In addition, reactions without templates or primers serverd as a negative control to exclude possible contamination. The thermal cycle program was set as the initial polymerase activation step, which was carried out for 30 seconds at 95 ℃, and then 40 cycles, including 15 seconds at 94 ℃ for template denaturation, 15 seconds at 55–65 ℃ for annealing, and 45 seconds at 72 ℃ for extension and fluorescence detection. All samples were amplified in triplicate. The specificity of RT-qPCR was confirmed by agarose electrophoresis and dissociation curve analysis. The cycle threshold for each reaction (Cq, the first cycle of the signal over the background) was automatically determined, by default parameters of the CFX Connect™ Real-Time PCR Detection System device.
Data Analysis
Based on the original fluorescence data obtained from Applied Biosystems 7300 Real-Time PCR System equipment, the Lin-RegPCR program was used to calculate the RT-qPCR efficiency and the correlation coefficients for each gene. The Cq value [20] used in the analysis represents the average of 6 values (3 biological repetition and 3 technical repetition) and a comparative Cq method was used to transform these values to relative quantities, according to the instructions of geNorm v3.5 and NormFinder v0.953 (www.gene-quantifification.info) [29].