Cells. U87MG (ATCC, Manassas, VA), HEK293 (Riken BRC, Ibaraki, Japan), HEK293T (Riken BRC), NIH/3T3 (ATCC), LM8 (Riken BRC), HCT116 (Riken BRC), SW480 (ATCC), SW620 (ATCC), EL4 (Riken BRC), and MG6 (Riken BRC) cell lines were maintained in Advanced DMEM (Thermo Fisher Scientific, Waltham, MA) supplemented with 2% heat-inactivated fetal bovine serum (FBS; Thermo Fisher Scientific), penicillin-streptomycin, and L-glutamine. K562 (Riken BRC), Jurkat (Riken BRC), and THP-1 (Riken BRC) cells were maintained in Advanced RPMI-1640 (Thermo Fisher Scientific) with 2% heat-inactivated FBS, penicillin-streptomycin, and L-glutamine. Human mesenchymal stem cells from adipose tissue (PromoCell, Heidelberg, Germany) were maintained in Cellartis MSC Xeno-Free Culture Medium (Takara Bio, Shiga, Japan) with Cellartis MSC Xeno-Free Supplement, and used in experiments by maximum 10 passages. H9C2 (ATCC) cells were maintained in high-glucose DMEM (Thermo Fisher Scientific) supplemented with 10% FBS, penicillin-streptomycin, and L-glutamine. All cells were cultured at 37°C with 5% CO2. To detect EVs, FBS was replaced with EV-free FBS, which was prepared by mixing 10 mL of heat-inactivated FBS with 2 mL of 50% PEG-10,000 (Merck, Darmstadt, Germany) by rotating at 4°C for 4 h. The supernatant was then collected after centrifugation at 2,000 × g for 20 min. HEK293T CASP3 KD cells were established via the CRISPR/Cas9 system. In brief, a pX330 plasmid targeting a sequence in the human CASP3 gene (GGAATGACATCTCGGTCTGG, PAM sequence is underlined) was transfected into HEK293T cells. After 3 days of selection with puromycin, CASP3 expression was determined via western blot analysis. All cell lines were tested for mycoplasma contamination by PCR targeting the 16S ribosome.
Chemical treatment. U87MG cells were seeded in Advanced DMEM-2% EV-free FBS containing 0.03% SphereMax (Nissan chemical, Tokyo, Japan) into 384-well plate or plates of other sizes, and treated with a chemical library, ionomycin (Merck), monensin (Merck), or DMSO (Merck). Other cells were seeded in Advanced medium-2% EV-free FBS into 96- or 24-well plates, and treated with a chemical library, ionomycin, monensin, or DMSO. After incubating the cells for 24 h, the plate was centrifuged at 1,200 × g for 60 min to separate the conditioned medium (1.2K sup) from the cells. A WST-8 assay (Nacalai Tesque, Kyoto, Japan) was used to evaluate cellular proliferation, according to the manufacturer’s protocols. To evaluate the amount of EVs or cytotoxicity, the 1.2K sup was subjected in TIM4-affinity ELISA or LDH assay. The LDH assay (Dojindo, Kumamoto, Japan) was performed according to the manufacturer’s protocol. In experiments performed on a larger than 384-well scale, the conditioned medium was separated by serial centrifugation at 300 × g for 5 min, 2,000 × g for 20 min, 10,000 × g for 30 min, and was then (10K sup) used in TIM4-affinity ELISA, NTA, or for the isolation of EVs.
TIM4-affinity ELISA. An ELISA plate (AGC Techno Glass, Shizuoka Japan) was coated with 1 µg/mL recombinant mouse TIM4-Fc protein/50 mM carbonate-bicarbonate buffer (pH 9.6) (FUJIFILM Wako Pure Chemical, Osaka, Japan) and incubated at 4°C overnight. The wells were blocked with 1% bovine serum albumin (BSA)/2 mM CaCl2/0.05% tween20/TBS buffer (TBS-TCa) for 1 h. Then, 1.2K sup or 10K sup supplemented with 2 mM CaCl2 was applied to the wells, and the cells were incubated for 1 h at room temperature. The captured EVs were labeled with each primary antibody/TBS-TCa for 2 h and then each HRP-conjugated secondary antibody for 1 h at room temperature. Finally, EVs were detected with TMB reagent (Nacalai Tesque) by measuring the absorbance at 450 nm. Primary antibodies against mouse CD9, mouse CD63, mouse/rat CD81, human CD9, human CD63, and human CD81 were purchased form Biolegend. HRP-conjugated secondary antibodies against rat IgG, Armenian hamster IgG, and mouse IgG were purchased from BioLegend, Jackson ImmunoResearch, and BioLegend, respectively.
Western blotting. Cells were lysed in RIPA buffer [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 2 mM EDTA, 0.5% sodium deoxycholate, 1% TritonX-100, 0.1% sodium dodecyl sulfate] with protease inhibitor cocktail on ice for 20 min, and then centrifuged at 14,000 × g, 4°C for 20 min to harvest the cell lysates. The cell lysates were separated by SDS-PAGE and transferred onto PVDF membranes. The membranes were blocked in 5% skim milk in 0.05% tween20/TBS buffer for 1 h, and then incubated with each primary antibody at 4°C overnight, followed by each HRP-conjugated secondary antibody. Immunoblot signals were captured using the Image Quant Las 4000mini (GE Healthcare, Chicago, IL) and SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific). Primary antibodies against caspase 3 and cleaved caspase 3 were purchased from Cell Signaling Technology (Danvers, MA), while those against β-actin were purchased from Merck. HRP-conjugated secondary antibodies against rabbit and mouse IgG were purchased from BioLegend.
NTA. The 10K sup was diluted to an appropriate concentration in PBS (-), and then the concentration of extracellular vesicles was determined using NanoSight LM10 (Malvern Panalytical, Malvern, United Kingdom). The movement of EVs was recorded three times at the same temperature for 30 s, and then analyzed using the NTA3.1 software.
Model of glioblastoma-derived EV-mediated angiogenesis. EVs were isolated from the 10K sup of U87MG cells following treatment for 2 days with DMSO or EV regulators, using the MagCapture™ Exosome Isolation Kit PS (FUJIFILM Wako Pure Chemical) according to the manufacturer’s instructions. After isolating EVs, the buffer was replaced with PBS (-) in dialysis. The effect of U87MG-EVs was evaluated in a model of EV-mediated angiogenesis, as previously reported43. Briefly, MG6 cells were seeded at 1 × 105 cells in a 24-well plate and cultured for 12 h. The cells were treated for 12 h with the indicated amounts of U87MG-EVs. After washing the cells with PBS (-), total RNA was extracted using RNeasy Plus Mini Kits (QIAGEN, Hilden, Germany). Single-strand cDNA was synthesized using ReverTra Ace qPCR master mix (TOYOBO, Osaka, Japan). Thbs1 or Gapdh gene was amplified and detected using the LightCycler 96 (Roche, Basel, Switzerland) with Universal SYBR Select master mix (Thermo Fisher Scientific) and paired primers, Thbs1-Fw; 5′-CACCTCTCCGGGTTACTGAG-3′ and Thbs1-Rv; 5′-GCAACAGGAACAGGACACCTA-3′, or Gapdh-Fw; 5′- GTGTTTCCTCGTCCCGTAGA-3′’ and Gapdh-Rv; 5′-AATCTCCACTTTGCCACTGC-3′.
Hypoxia-induced cardiomyocyte apoptosis assay. To isolate EVs, 4 × 105 hMSCs were cultured for 4 days and then treated for 2 days with DMSO or EV regulators. The EVs were isolated from 10K sup of the hMSC-conditioned medium using the Capturem™ Exosome Isolation Kit (Takara Bio), according to the manufacturer’s instructions. After isolating EVs, the buffer was replaced with PBS (-) using the Amicon Ultra PLGC Ultracel column, 10 membrane, 3 kDa column (Merck). To induce hypoxia-induced apoptosis, 5 × 104 H9C2 cells were cultured for 1 day in DMEM-10%FBS, followed by 1 day in DMEM-10%FBS containing 1 mM CoCl2 (FUJIFILM Wako Pure Chemical), and 4 days in DMEM-10%FBS containing the EVs from hMSCs treated with DMSO or EV regulators. The cells were used to perform a in CellTiter-Glo Luminescent Cell Viability Assay (Promega, Madison, WI) according to the manufacture’s protocols.