Samples, isolation of bacterial strains, media, and growth conditions
Isolation of LAB strains was performed from vacuum-packed organic meat sausages bought from Solico Group Co Ltd. (Tehran, Iran). Twenty packs of fresh organic meat sausages were bought from local markets. All packs were kept on ice bags, transferred into the laboratory, and refrigerated at 4 °C. For isolation of the bacteria, each pack was opened with a sterile scissor and cut into small pieces using a sterile knife, and 1 gram of the obtained pieces was homogenized in normal saline solution. One milliliter of homogenized solution in normal saline was added to 9 ml of trypticase soy broth (TSB) medium to obtain a 1:10 initial dilution. Then, 100µl of each dilution was streaked on the MRS agar plate. Incubation was performed at 28 °C for 24h. MRS agar plates containing between 50 to 100 colonies, were overlaid with MRS soft agar (0.8%) seeded with Micrococcus luteus PTCC 1408 as an indicator bacterial strain, and incubation was performed at 28 °C for 24h for observing the clear zone of growth inhibitions. Colonies showing reasonable zone of growth inhibition were picked up and transferred to MRS agar plates for obtaining pure culture.
Phenotypic, biochemical, and molecular characterization of the isolates
Phenotypic characterization including Gram staining, colony size, and morphology, biochemical tests such as carbohydrate fermentation, catalase activity, growth at 15°C and 45°C, growth at 4% and 6.5% NaCl, and motility were carried out according to Bergey’s Manual of Systematic Bacteriology were used for identification and characterization of the LAB isolates (Vos et al., 2011).
For taxonomic study of isolates, the 16S rRNA analysis was performed. The genomic DNA was extracted from single colonies of the bacterial strains, using a Qiagen DNeasy blood and tissue kit (QIAGEN N.V, Germany) (following the manufacturer’s instructions). For all five isolates, the bacterial 16S rRNA were amplified using the forward 27f: 5'-GAGTTTGATCCTGGCTCAG -3' and reverse 1505r: 5’- GATACGGCTACCTTGTTACGA -3' primers. The PCR program was performed in a Techne FTC51S5D Thermocycler (Staffordshire, UK) for 35 cycles under the following temperature profile: 95°C for 3min (1 cycle); 93 °C for 45 s, 58 °C for 1min, and 72 °C for 90 s (35 cycles); and 72 °C for 10min at the end of the final cycle. The PCR product was purified using a GF-1 PCR Cleanup kit (Vivantis technologies, Malaysia). The purified products were sequenced using the below primers:
27f: 5'-GAGTTTGATCCTGGCTCAG -3', 16r339: 5’- ACTGCTGCCTCCCGTAGGAG -3’
16f358: 5’- CTCCTACGGGAGGCAGCAG-3’, 704f: 5’- GTAGCGGTGAAATGCGTAGA- 3'
1505r: 5’- GATACGGCTACCTTGTTACGA -3'
The Sanger’s dideoxy chain-termination sequencing method was used with an ABI 3730XL DNA analyzer (Thermo Fisher Scientific Inc. USA). The similarities between
16S rRNA sequences were compared in the National Center for Biotechnology Information
(NCBI), Ribosomal Data Base. The phylogenetic tree based on 16S rRNA gene sequence was created against different related strains according to the partial sequence analysis. The evolutionary distances were calculated using the Maximum Composite Likelihood method and are in the units of the number of base substitutions per site. This analysis involved 28 nucleotide sequences. All locations with less than 95% site coverage were eliminated, i.e., fewer than 5% alignment gaps, missing data, and ambiguous bases were allowed at any position (partial deletion option). Phylogenic dendrograms were generated through the neighbor-joining method with a bootstrap test (1,000replicates) using MEGA X (Kumar et al., 2018; Tamura et al., 2004).
Primary antibacterial activity determination by the LAB isolates
Antibacterial activity of Lactobacillus isolates was determined using the spot-on lawn assay method suggested by Denkova (Denkova et al., 2017) with some modifications. The Lactobacillus isolates were grown in MRS broth overnight. Then, cell-free supernatants (CFS) were collected by centrifugation (10000 g at 4°C for 10min), and filter sterilized using a 0.2µ (Whatman membrane filter, Merck Darmstadt, Germany). Then, MRS agar plates were overlaid with 5 ml melted soft agar (0.7%) inoculated with 100 µl of an overnight culture of M.luteus PTCC 1408 (∼ 108 CFU/ml) as the indicator strain. Then, 20 µl of each crude filtered CFS (pH 4.7) of Lactobacillus strains was spotted on the medium inoculated with the test strain. The incubation was performed at 37°C for 24h. The clear zones surrounding each spot indicate the antibacterial activity regarding the bacteriocin production by LAB strains against Micrococcus luteus PTCC 1408.
Determination of the antibacterial activity of produced bacteriocin by LAB isolates against some selected food-borne pathogens
For the determination of the antibacterial activity of the bacteriocin produced by the selected Lactobacillus isolates the spot-on lawn and agar disk diffusion methodswere used against some selected food-borne pathogens. The selected food-borne pathogens including, Salmonella enterica subsp. enterica serotype Typhimurium PTCC 1709, Staphylococcus aureus PTCC 1113, Listeria monocytogenes PTCC1302, and Listeria inovani PTCC 1303 were obtained from Persian Type Culture Collection (PTCC, Tehran, Iran). For the spot-on lawn method, Lactobacillus strains were grown in MRS broth (Merck Co. Darmstadt, Germany) at pH 6.8 and maintained aerobically at 35°C for 48 h. The bacterial cells were removed from the growth medium by centrifugation (10000X g for 30 min at 4°C) and passed through the Whatman membrane filter (0.2 µm diam. 47 mm). Then, pre-poured MRS agar plates were overlaid with 5ml melted soft agar (0.7%) inoculated with 100 µl of overnight cultures
(∼ 108 CFU/ml) of the selected food-borne pathogens. In the next step, 20 µl of each crude filtered of Lactobacillus isolates was spotted on the MRS media. For the agar disk diffusion, the method described by Balouiri et al. 2016 was used (Balouiri et al., 2016). Agar plates containing MRS medium were inoculated with 100µl of test strains and streaked using a glass spreader. Then, blank filter paper discs (about 6 mm in diameter) were placed on the agar surface. Then, 20 µl of each crude filtered Lactobacillus isolates containing were added to filter paper discs.
The incubation was performed at 37°C for 24h. The clear zones surrounding each spot indicate the antibacterial activity regarding the bacteriocin production by LAB strains against selected foodborne pathogens. The activity of cell-free supernatant was described in arbitrary units per ml (AU/ml). A unit activity of the bacteriocin was defined as an arbitrary unit (Mathur et al., 2017); 1 AU is a unit area of inhibition zone per unit volume, in this case, mm2/ml (Usmiati and Marwati, 2009). The bacteriocin activity was determined using the following formula: Bacteriocin activity (mm2/ml) =Lz-Ls/V which the parameters are LZ=clear zone area (mm2), Ls=well area (mm2), and V=volume of the sample.
Determination of the antimicrobial activity of bacteriocin production by the
MN-B isolate
The growth and antimicrobial activity of bacteriocin produced by the selected P. acidilactici sp. (MN-B) was evaluated against Lactobacillus casei ATCC 39392 using MRS broth medium. 250 mL of MRS broth at pH 6.8 was inoculated with (1% v/v) cell suspension of P. acidilactici sp. (MN-B) and incubated at 37 °C without agitation; in the presence of nitrogen for 48 h. Bacterial cell optical density, antimicrobial activity against Lactobacillus casei ATCC 39392 strain,and pH were measured every 2 and 4 hours during the fermentation process.
Determination of minimum inhibitory concentration
For the determination of minimum inhibitory concentration, a serial dilution method for the crude bacteriocin, and selected antibiotics were used in Mueller Hinton broth (Sigma-Aldrich) medium, according to CLSI M7-A8 and M100-S28-2018 guidelines. Serial two-fold dilution (50, 25, 12.5, 6.25, 3.125, 1.56, 0.78 and 0.39 µg/ml) of the cell-free extract of bacteriocin, and antibiotics (64, 32, 16, 8, 4, 2 and 1µg/ml) with bacterial concentration (108 CFU/ml 0.5 McFarland’s standard) were used to determine MIC in MH broth. The control was only inoculated broth with the MN-B strain and incubated for 24 h at 37° C. The MIC endpoint is the lowest concentration of antimicrobial components where no visible growth is seen in the tubes. The turbidity of the tubes was distinguished, both before and after incubation to approve the MIC value.
Partial purification of bacteriocin produced by the MN-B strain
Bacteriocin produced by the MN-B isolatewas purified using the adsorption-desorption method (Charan Day et al. 2019) with some modifications (Dey et al., 2019).
For purification, the MN-B isolate was inoculated in 1-liter MRS broth (pH 6.5) and incubated at 37 °C for 24 h in a rotary shaker 150 rpm. Samples of culture were taken at 12, 16, 18, 22, and 26h of incubation, respectively. Each sample was heat-killed and cooled at room temperature. Then, the pH culture was adjusted to 5.5-5.6 by 10 (N) NaOH and incubated at 37 °C for 4 h in a rotary shaker at 150 rpm, in order to adsorb the bacteriocins to the producer cells. In the next step, cells were centrifuged at 15,000 rpm for 6 min at 4 °C, then washed twice with sterile
5mM sodium phosphate buffer pH 5.5 and again centrifuged at 15,000 rpm for 6 min at 4°C. Then, pellets were resuspended in 100 mM NaCl buffer (pH 1.5), the pH of which was adjusted with 5% phosphoric acid and stirred for 2 h at 4°C. The cell-free supernatant (CFS) was collected by centrifugation and dialyzed in a dialysis bag (Mol. Cut off 1.0 kDa, Sigma, USA) and used as partially purified bacteriocins. In each step of purification, the amount of proteins were quantified by the Bradford method using bovine serum albumin (BSA) as standard (Kruger, 2009).
SDS–PAGE analysis
Partially purified bacteriocin produced by the isolate MN-B was concentrated ten-fold and separated by the Lammeli method using 15% separating gel and 5% stacking gel with acrylamide and bis-acrylamide ratio 30:1 under denaturing condition (Laemmli, 1970). 30µl of partially purified bacteriocin was mixed in a 4:1 ratio with denaturing sample buffer and loaded in a well.
Electrophoresis was performed at 20 mA for the first 20 min and then the next 1 h at 25 mA. Then, the gel was removed and stained with Coomassie brilliant blue R-250. For confirmation of the protein bands as bacteriocins in the SDS-PAGE analysis, an activity gel study was performed. The gel was washed in sterile double distilled water containing 0.1% Tween 80 for 24 and used for antimicrobial activity assessment. Then, the gel was placed on a pre-poured MRS agar plate and overlaid with 10 ml melted MRS soft agar (0.6%, w/v) seeded with Lactobacillus casei ATCC 39392 as the sensitive indicator strain. The plate was incubated at
37 °C for 24 h and a zone of growth inhibition was observed (Dey, et al. 2019; Mandal, et al. 2011).
Statistical Analysis
In this study, all data were expressed as mean ± standard deviation (SD) of triplicate independent experiments. All statistical evaluations were performed with the SPSS/PC software, version 20.0. The T-student test was used to evaluate the significance of obtained data. P-value <0.05 considered significant.