Cell culture
MCF7, MDA-MB-231, MDA-MB-468 and T47D cells were obtained from the NCCS cell repository, Pune, India. MCF7, MDA-MB-231 and MDA-MB-468 were cultured in DMEM (Gibco) and T47D was cultured in RPMI (Gibco). All the cell lines were supplemented with 10% Fetal Bovine Serum (FBS) (Gibco) and 100 units/ml Penicillin and Streptomycin (Gibco) and incubated in a humidified 5% CO2 incubator at 37ºC.
Plasmids, siRNAs and shRNA constructs
3xFlag26-SMAR1 was used to over-express SMAR1 and 3xFlag26-Vector was used as a control. Silencer™ Select Negative Control No. 1 siRNA (4390843) and si-RNA against human-SMAR1 (BANP) (s29889) were obtained from Thermo Fischer Scientific Silencer® select siRNA range. shSMAR1-eGFP (ULTRA-3344235) was obtained from TransOMIC and used for shRNA-mediated SMAR1 knockdown. shNon translated-1-eGFP (shNT1) (TLNSU1420) was also obtained from TransOMIC and used as a control for all shRNA-mediated knockdown studies. shHDAC6 clone TRCN0000004839 was used for HDAC6 knockdown28. shPKM2 was cloned in pLKO.1-TRC vector and the sequence targeting only PKM2 were obtained from Cortés-Cros et al.30. The sequence of shPKM2 used:
5′CCGGCTACCACTTGCAATTATTTGACTCGAGTCAAATAATTGCAAGTGGTAGTTTTTG3′.
Transfections and treatments
Transfections of various plasmids were done by the use of Polyethylenimine (PEI MAX 40000) (Polysciences, Inc.). In MCF7, transfection was performed at 70-80% confluency and the DNA:PEI ratio used for transfection was 1:3. In MDA-MB-231, reverse transfection was performed in which DNA: PEI mix was added before cell seeding. Tubacin (Sigma), a selective HDAC6 inhibitor, was used at 5 μM concentration for 5 hrs for optimum HDAC6 inhibition and an equal amount of DMSO was used as vehicle control.
Cloning of dual reporter PKM minigene system
To develop a dual chromatic PKM minigene system, eGFP was cloned into mCherry-N1 vector between SalI (NEB) and AgeI (NEB) restriction sites in such a way that both eGFP and mCherry remain in two different frames due to difference in one base pair and eGFP contains stop-codon at the end when in the frame. Further, Exon 8 - Exon 11 of the PKM gene along with introns was amplified from PKM minigene construct31 (a kind gift from Dr. Adrian R. Krainer) using Platinum™ SuperFi™ DNA Polymerase (Invitrogen) and cloned into this vector between XhoI (NEB) and NdeI (NEB) sites by Infusion cloning (NEB). One base pair insertion was further introduced in the cloned plasmid in Exon 10 by Infusion cloning. Due to one base pair insertion, the incorporation of Exon 9 resulted in the expression of mCherry and the incorporation of Exon 10 led to the expression of eGFP. The expressions of mCherry and eGFP were analyzed by confocal microscopy.
Dual reporter PKM minigene assay
MCF7 cells were seeded onto a glass coverslip and after 24 hrs PKM minigene along with control or Flag-SMAR1 in a 1:1 ratio was introduced in these cells by PEI mediated transfection. After 48 hrs of transfection, cells were fixed with 4% paraformaldehyde for 10 mins at room temperature. Subsequently, cells were washed with 1X PBS thrice and the coverslips were mounted in fluoroshield media (Sigma) with DAPI. Cells were observed at 60X magnification using Nikon A1plus confocal microscope and images were acquired using Nikon’s NIS-elements imaging software. For eGFP and mCherry fluorescent intensity quantification, ImageJ software was used. Five independent regions of interest (ROIs) were selected per image covering cells expressing eGFP and mCherry and fluorescence intensity density was measured. Average relative fluorescence densities were calculated for all five ROIs per field and the fold change in eGFP/mCherry ratio was calculated. For statistical significance, three random fields per sample were selected and three independent experiments were performed. Mean ± SD fold change in eGFP/mCherry ratio was calculated for each sample and compared with the control sample.
Immunohistochemistry (IHC)
Paraffinized human breast cancer patient samples along with surrounding normal breast tissue were obtained from Ruby Hall Clinic, Pune, India. SMAR1, PKM1 and PKM2 expression were detected using standard immunohistochemical staining procedure. Briefly, after deparaffinization, endogenous peroxidase blockage and rehydration with decreasing concentrations of ethanol (100%, 95% and 70%), antigen retrieval was performed by heating the slides in 10 mM sodium citrate buffer (pH 6-7). Further samples were incubated with the antibody of SMAR1 (Bethyl) at 1: 100 dilution, PKM1 (CST) at 1: 100 dilution and PKM2 (CST) 1: 300 dilution overnight at 4ºC. After incubation with HRP-conjugated secondary antibodies for 1 hr at room temperature, sections were then treated in DAB (3,3'-Diaminobenzidine) for 15 mins to allow the development of brown precipitate corresponding to the sites of HRP-bound antibodies. Samples were washed and counterstained with Hematoxylin for nuclei staining. Tissue sections were observed at 20X magnification using a Nikon microscope (Eclipse E600) and images were acquired using Nikon’s NIS-elements imaging software.
Quantitative RT PCR
Total RNA was extracted from cultured MCF7 cells and MDA-MB-231 cells by TRizolTM (Invitrogen) according to the manufacturer’s instruction. RNA was reverse transcribed by MMLV-RT (Invitrogen) as per the manufacturer’s instructions. Amplification reactions were prepared in triplicate using iQTaq SYBR green (Biorad) and amplification was performed on Eppendorf realplex 2.0 according to the manufacturer’s instruction. The average cycle thresholds from three independent biological replicate samples were calculated as described in Singh et al. with slight modifications32. Briefly, the average cycle thresholds from three independent biological replicate samples were normalized to housekeeping control gene 18S rRNA. Normalization was performed using 18S rRNA as a normalization control using the formula: [2^ (Ct control – Ct target)]. Along with control gene normalization, constitutive exon (exon 11) normalization was performed for PKM1 (Exon 8-9/9) and PKM2 (Exon 10-11/11) expression analysis. The student’s t-test was used to compare expression between two different groups. A list of primers used is given in Table S1.
Western blotting
Cells were incubated in TNN buffer [50 mM Tris-Cl pH 7.5, 5 mM EDTA, 0.5% NP40, 50 mM NaF, 1 mM DTT, 0.2 mM sodium orthovanadate, 0.5 mM PMSF, 150 mM NaCl and 1X Protease inhibitor cocktail (Thermo Scientific)] for cell lysis and lysates containing equal concentration of proteins were resolved using SDS-PAGE and transferred onto PVDF membrane. The membranes were incubated with primary antibodies such as anti-SMAR1 (Bethyl - A300-279A), Anti-PKM1 (CST- 7067), Anti-PKM2 (CST- 4053), Anti-hnRNP A1(CST- 8443), Anti-hnRNP A2 (Abcam- ab6102), Anti-PTBP1 (Thermo Scientific- 32-4800), Anti-HDAC6 (CST- 7558), Anti-HDAC1 (CST- 5356), Anti-GFP (Proteintech- 66002-1-Ig), Anti-mCherry (Proteintech- 26765-1-AP), Anti-β-actin (Sigma- A2228) and Anti-Flag tag (CST- 14793). This was followed by three washes and incubation with appropriate HRP conjugated secondary antibodies. Visualization was achieved with ECL substrate (Pierce) and exposure to X-ray films or imaging in Syngene G:BOX Chemi XRQ.
Antibody cross-linking, Co-Immunoprecipitation and sequential Co-Immunoprecipitation
The majority of Immunoprecipitation (IP) experiments were done via covalently cross-linking the antibody with Protein G Dynabeads (Pierce) to avoid non-specific binding and contamination of immunoglobulin in the immunoprecipitated protein eluates. Approximately 1 µg of antibody was cross-linked with 10 µl of beads. Beads were washed thrice with ice-cold 1X PBS and further incubated with the desired antibody in IP buffer (1X PBS with 0.1% NP-40) containing protease inhibitor cocktail (Pierce). The antibody-bead mixture was incubated overnight at 4ºC. The unbound antibody was removed by three wash of the antibody-bead complex with IP buffer. Further, the antibody-bead complex was incubated with 500 μL of 10 mg/ml of Dimethyl pimelimidate (DMP) (Sigma) for 60 mins at room temperature with rotation. 50 μL of 1M Tris-Cl pH 8 was added to quench the reaction and incubated for 30 mins at room temperature with rotation. Unbound antibody was removed by washing it with 0.2 M Glycine pH 3 followed by three washes with IP buffer. The antibody-bead complex was further equilibrated with the IP buffer. These beads were either used immediately or stored at 4ºC for 2-3 days. Protein-bound to the antibody-bead complex was eluted at 95ºC by using SDS loading dye.
For IP experiments, 500 µg of nuclear extracts were pre-cleared with control normal IgG (Sigma) bound dynabeads G and subsequently incubated for 12 hrs at 4ºC with dynabeads G crosslinked with the desired primary antibody. The protein associated bead complexes were washed thrice with IP buffer and then further eluted with SDS loading dye. The eluates were probed with indicated antibodies.
For sequential IP experiments, nuclear extracts (1 mg) were immunoprecipitated first with 3 µg of anti-SMAR1 antibody. Before proceeding for the second IP, a minor fraction of the eluates was examined for the presence of HDAC6. Subsequently, the eluate was immunoprecipitated with 2 µg of anti-HDAC6. The final eluates were probed with anti-PTBP1 to evaluate the association.
Anti-Acetyl-Lysine Acetylation Assay
For assessing the acetylation status of protein, 1 mg of nuclear extract was incubated with 2 μg of anti-acetyl-lysine antibody (CST- 9441) crosslinked with dynabeads G at 4ºC with slight mixing for 12 hrs. Immunocomplexes were washed thrice with 500 μL of IP buffer and further eluted at 95ºC with SDS loading dye. The eluates were loaded onto the SDS-PAGE and immunoblotted with indicated antibodies.
UV-crosslinking and RNA immunoprecipitation (CLIP)
CLIP experiment was done via covalently cross-linking the anti-PTBP1 antibody with Protein G Dynabeads (Thermo Scientific) as described in antibody cross-linking. Normal mouse IgG crosslinked beads were used as a negative control. Antibody cross-linked beads were further blocked for 1 hr at 4ºC with 100 nM yeast tRNA to avoid non-specific binding with RNA. Cells were washed with ice-cold 1X PBS, UV-irradiated (150 mJ/cm2) and harvested and lysed with lysis buffer (100 mM KCl, 5 mM MgCl2, 10 mM HEPES - pH 7.0, 0.5% NP40, 1 mM DTT, 100 units/ml RNase Out and Protease inhibitor cocktail) for 10 mins on ice. RNase A (1:1000 dilution) and DNase I (Invitrogen) was added to the lysate and incubated at 37ºC for 3 mins. 5% lysate was taken as input and TRizol LSTM (Invitrogen) was added for RNA extraction. An equal amount of protein (10 mg) was taken for control and SMAR1 knockdown sample and anti-PTBP1 and normal IgG conjugated beads were added for immunoprecipitation and incubated on rotation at 4ºC for 3 hrs. After two washes with wash buffer (50 mM Tris-HCl - pH 7.4, 150 mM NaCl, 1 mM MgCl2, 0.05% NP40) supplemented with RNase inhibitor, an aliquot (10%) of beads was kept as control of immunoprecipitation while the rest was treated with 30 μg of Proteinase K and incubated for 1 hr at 55ºC. RNA was then extracted by TRizol LSTM (Invitrogen) and RNA was reverse transcribed by MMLV-RT (Invitrogen) as per the manufacturer’s instructions. Immunoprecipitated fractions and 5% input were analyzed by quantitative real-time PCR in duplicate using iQTaq SYBR green (Biorad) and amplification was performed on Eppendorf realplex 2.0 and specific primers for PTBP1 binding site on Intron 8 of PKM were used (sequences mentioned in Table S1). Primer sequence for PKM Intron 8 PTBP1 binding site was obtained from Chen et al.13. The experiment was performed three times and normalization was performed to input using the formula: [2^ (Ct input – Ct immunoprecipitation)]. Fold enrichment was calculated relative to normal mouse IgG control. Resultant fold enrichment was further normalized with densitometry measurement of a western blot for immunoprecipitated PTBP1 protein samples. The student’s t-test was used to identify the significance between two different groups.
Glucose Assay
MCF7 cells were transfected with respective shRNA and control shRNA. shRNA transfected cells were selected with puromycin and an equal number of cells were plated in a 6 well plate. After 24 hrs, the cells were replenished with 10% FBS containing high glucose DMEM (without sodium pyruvate). After 24 hrs of media replenishment, media was collected and the amount of glucose was calculated with the use of a Glucose Assay Kit (Abcam, ab65333) as per the manufacturer’s protocol by colorimetric method. The amount of glucose present was normalized with the total amount of protein. The glucose utilization was calculated by subtracting the glucose level of samples from that of cell-free media. The percentage of glucose utilization was calculated compared to the control.
Lactate assay
MCF7 cells were transfected with respective shRNA and control shRNA. shRNA transfected cells were selected with puromycin and an equal number of cells were plated in a 6 well plate. After 24 hrs, the cells were replenished with 10% FBS containing high glucose DMEM (without sodium pyruvate). After 24 hrs of media replenishment, media was collected and the amount of lactate was calculated with the use of a Lactate Assay Kit (Abcam, ab65331) as per the manufacturer’s protocol. The amount of lactate present in each sample was normalized with the total amount of protein. The percentage of lactate production was calculated for each sample compared to the control.
Glucose (2-NBDG) uptake assay
MCF7 cells were transfected with SMAR1 siRNA and control siRNA by Lipofectamine RNAiMaxTM (Ambion) according to the manufacturer’s protocol. After 24 hrs of transfection, media was removed and replenished with 10% FBS containing DMEM (Without glucose and Sodium Pyruvate) and incubated at 37ºC for 1 hr. 10 μM fluorescent d-glucose analog 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxy-d-glucose (2-NBDG) (Invitrogen) was added to culture media and cells were incubated for 1 hr at 37ºC. The 2-NBDG uptake reaction was stopped by removing the incubation medium and the cells were washed with ice-cold 1X PBS. 1 μg/ml Propidium Iodide (PI) was added to distinguish the viable cell population. For each measurement, data from 10,000 single-cell events were collected using FACS Canto II (BD Bioscience). The percentage of 2-NBDG uptake was calculated from mean fluorescence intensity (MFI) compared to the control.
Cell viability assay
MCF7 cells were transfected with BORIS shRNA and shNT1 was used as a control in six-well culture plates. After the selection of transfected cells with puromycin, cells (4x103) were seeded in 96 well culture plates and were cultured for 24 hrs, 48 hrs, and 72 hrs. Cell growth was determined by measuring the conversion of MTT Tetrazolium salt (Sigma) to MTT formazan. In brief, 50 µl of MTT stock solution (5 mg/ml) was added to each well along with 50 µl of 10% FBS containing DMEM and incubated for 4 hrs. After the incubation time, formazan crystals formed in the cells were solubilized in Isopropanol. The cell viability was measured by Spectramax M5 (Molecular Devices) at an optical density of 570 nm. The percentage proliferation was calculated and cell viability at 0 hr for each sample was considered as 100%. Compared to 0 hr, the percentage of proliferation was calculated for other time points.
Colony formation assay
MCF7 cells were transfected with respective shRNAs and shNT1 was used as a control. The cells were selected with puromycin and 1x103 cells were seeded in the new 6-well plate. After 10 days, cells were fixed using methanol and acetic acid (3:1) for 5 mins. After fixation, cells were washed with 1X PBS thrice. After washing cells were stained with 0.05% crystal violet stain, images were taken and colonies formed were counted manually with help of ImageJ software. The percentage of colony formation was calculated for each sample compared to the control.
Transwell migration and invasion assay
Transwell chamber: 24-well, 8.0-μm pore membranes (Corning USA) were used according to the manufacturer’s protocol. MCF7 cells were transfected with respective shRNAs and shNT1 was used as a control. After the selection of transfected cells with puromycin, 1x105 cells per well were seeded in the upper chamber in a serum-free medium, and DMEM with 5% FBS was added to the lower chamber as a chemoattractant at the same time. After incubation of 24 hrs at 37ºC, the cells remaining at the upper surface of the membrane were removed with cotton swabs, and the cells on the lower surface of the membrane are the migrated cells. After fixation with 4% paraformaldehyde and staining with 0.5% crystal violet solution, the cells were observed at 10X magnification using the Nikon microscope (Eclipse Ti2) and images were acquired using Nikon’s NIS-elements imaging software.
The transwell invasion assay was carried out as described above, except that a transwell chamber with Matrigel (Corning, USA) was used and they were pre-incubated at 37ºC after hydration with 100 μL of serum-free medium for 2 hrs before the cells were seeded onto the membrane, followed by incubation of 48 hrs at 37ºC. Five fields were randomly captured and the number of migrating/invading cells were quantified manually with the help of Image J software. The percentage of migration/invasion was calculated for each sample compared to the control.
Wound healing assay
MCF7 cells were transfected with respective shRNAs and shNT1 was used as a control. The cells were selected with puromycin and 1.5x105 cells were seeded in each well of 12 well plate and allowed to grow at 37ºC to form a monolayer. Cells were synchronized by serum starvation for 12 hrs and scratch was introduced in the middle of the monolayer by sterile pipette tip, generating a cell-free area of approximately 1 mm in width and cell debris was removed by washing twice with 1X PBS. Three fields per well were imaged in the area where the wound was introduced at 0 hr 24 hrs. The area of the wound was measured by ImageJ for 0 hr and 24 hrs and the percentage of wound migration was calculated compared to that of the control. All images were taken at 10X magnification using the Nikon microscope (Eclipse Ti2) with help of Nikon’s NIS-elements imaging software.
In vivo tumor generation
All mice used in this experiment were bred at the animal resource facility of NCCS, Pune, India. Standard protocols approved and monitored by the Institutional Animal Ethical Committee were followed for this experiment. The MDA-MB-231 cells were transduced with SMAR1-adenovirus and control-adenovirus. 1 million cells were injected subcutaneously in 6-8 weeks old NOD/SCID mice. After 1 month of injection, mice were sacrificed and tumors were dissected. The volume and weight of tumors were measured and parts of the tumor were utilized for western blot and immunohistochemistry as described in the above section.
Statistical analysis
All statistical analysis was performed using Microsoft Excel and graphs were plotted using GraphPad Prism7. Data has been represented as mean ± SD. The student’s t-test was used to determine the statistical significance of the difference between the groups. The p-value of < 0.05 was considered significant. * p <0.05, ** p <0.01 and *** p <0.001. Images were analyzed and quantified using ImageJ software.