Cloning, expression and purification of SARS-CoV-2 receptor binding domain
The coding sequence of the SARS-CoV-2 spike protein was amplified by PCR using a template kindly provided by Dr. Peter Cherepanov. The PCR product, together with two gene fragments encoding the GP67 leader sequence and a C-terminal Avitag-HRV3C-His8 tag, were assembled using NEBuilder HiFi (NEB) into the p10 promoter of a pFBDM baculovirus expression vector that had been digested with XmaI & KpnI.
Baculovirus were generated according to Bac-to-Bac protocols (Invitrogen) and used to infect 800 ml of High Five™ cells grown in shaker cultures at 270C with Sf-900™ III SFM. After 5 days the culture media was collected, clarified by centrifugation (30 min, 10,543 x G) and concentrated over 8 fold using a Vivaflow 200 Crossflow Cassette (Sartorius). HEPES pH7.4, NaCl & glycerol were added to give final concentrations of 50mM, 150mM and 5% respectively, prior to freezing.
The protein was purified by nickel affinity purification. 100 ml of concentrated media was thawed, filtered through 1.2 mm syringe filters and applied to a 5mL HisTrap™ Excel. The column was sequentially washed with 50 ml 4% buffer B (20 mM Tris pH8.0, 150 mM NaCl, 500 mM imidazole), 17 mL 8% buffer B & 17 mL 16% buffer B, prior to elution with 17 mL 100% buffer B. Eluted protein was incubated with HRV3C protease (19U/mg substrate), BirA (1mg/nmole substrate), biotin (10 x [substrate]), ATP (1 mM) & MgCl2 (3.3 mM) for 5 hours prior to loading onto a HiLoad® 26/600 Superdex® 75 pg column (running buffer 20 mM Tris pH8.0, 150 mM NaCl) with a 1ml GSTrap FF column in series. Peak fractions were pooled and reapplied to the 5 ml HisTrap™ Excel column. Flow through fractions were pooled, concentrated & frozen.
All columns were from Cytiva life sciences (formerly GE Healthcare).
Cloning, expression and purification of SARS CoV-2 S1 spike protein
The PCR product of the SARS-CoV-2 spike S1 protein was cloned into pTT5 for expression in Expi293F cells. Cells were seeded to 1.5 x 106/ml and cultured overnight and transfected. 60mg of pTT5-CoV-2 RBD plasmid DNA was added to 3ml of Opti-Mem (Thermofisher). and 160ul of ExpiFectamine (Thermofisher) added to 3ml of Opti-Mem and both incubated for 5min at room temperature. These were mixed and further incubated at room temperature for 30min before adding the DNA-reagent complex to the Expi293 cells and incubating at 37°C, 5% CO2 with continuous mixing at 125rpm. 300ul of enhancer 1 and 3ml of enhancer 2 solutions were added 16-18 hours post transfection and cells incubated the 37°C, 5% CO2 for a further 5 days with mixing at 125rpm. Purification was carried as described for the SARS-CoV2-RBD.
Cloning and expression of recombinant ACE2 and anti-CoV2 antibody fragments
The various constructs for ACE2 proteins (ACE2-Avi-HIS; ACE2-Fc; ACE2-Fc-TD) and anti-SARS-CoV-2 antibody fragments in the Quad format (CR3022-Fab-TD, CR3022-scFv-TD, B38-Fab-TD, H4Fab-TD, H4-scFv-TD, CR3014-Fab-TD) were cloned and expressed in pTT5 25. The sequences of the coding regions of each are shown in Supplementary Figure 3.
All proteins produced by secretion from Expi293F cells (Thermofisher) as described for the SARS-CoV-2 spike S1 protein. For the anti-SARS-CoV-2 Quad antibodies, cell supernatants were purified by nickel affinity chromatography and SEC. Approximately 60 ml of filtered culture media was applied to a 5 ml HiTrap® QFF column. Following a 25 ml wash with 20 mM Tris pH8.0, 100 mM NaCl, a gradient was developed from 0% to 50% 20 mM Tris pH8.0, 150 mM NaCl, 500 mM imidazole over 100 ml.
ACE2 proteins were purified using HiTrap® QFF column as for the antibodies and the peak fractions were pooled, concentrated and applied to a HiLoad™ 16/600 Superose™ 6 prep grade column in running buffer 1 x PBS (Oxoid™ PBS Tablets, Thermo Scientific™). Peak fractions were pooled & concentrated.
SEC-MALLS
SEC-MALLS experiments were performed using a Superose 6 10/300 Increase column (GE Healthcare) and an OMNISEC SEC-MALLS system (Malvern). The samples (100 μL, 1 mg/mL) were loaded onto the gel filtration column pre-equilibrated with PBS and eluted with one column volume (24 mL) of buffer, at a flow rate of 0.5 mL/min. Data were analysed using the OMNISEC software, using a refractive increment value of 0.185 mL/g.
Analytical ultracentrifugation
Sedimentation velocity experiments were performed at 40000 rpm, using a Beckman Optima analytical ultracentrifuge (AUC) with an An-50Ti rotor at 20˚C. Data were recorded using the absorbance (at 280 nm) optical detection system. The density and viscosity of the buffer (PBS) was measured experimentally using a DMA 5000M densitometer equipped with a Lovis 2000ME viscometer module. The partial specific volume of the protein was calculated using SEDFIT from the amino acid sequence. Data were processed using SEDFIT, fitting to the c(s) model. Figures were made using GUSSI software.
SEC-SAXS
All SAXS data were collected at beamline B21 (Diamond Light Source, UK) operating in SEC-SAXS mode and using an EIGER 4M detector. Prior to data collection all protein samples were centrifuged at 15,000g for 5 minutes to remove any insoluble aggregates. SEC-SAXS was performed using a Superose 6 10/300 Increase column (GE Healthcare) pre-equilibrated with PBS + 2% sucrose, where sucrose is added to minimise radiation damage during data collection. Protein samples (45 μL, 5 mg/mL) were injected onto the column and eluted with one column volume (24 mL) of buffer, at a flow rate of 0.5 mL/min. Scattering curves were collected throughout the elution and analysed using the SCÅTTER IV software suite. Molecular envelopes were calculated using DAMMIN 26 with envelopes representing the average of 13 independent runs. Representative models for ACE2-gG and ACE2-IgG-TD were manually constructed in COOT 27 using PDB files 1R42 (ACE2), 1HZH (IgG) and 1C26 (P53) and fitted to the molecular envelope using 28.
Surface plasmon resonance of ACE2 proteins binding SARS-CoV-2 RBD
SPR experiments were carried out using Biacore T100 (Cytiva, formerly GE Healthcare) in PBS buffer, pH 7.4 containing 0.05% Tween-20. A streptavidin-coated SA chip (Cytiva) was washed with 3 x 30s injections of 1M NaCl/50mM NaOH at 10µL/min before biotinylated SARS-CoV-2-RBD0.2µg/mL) was captured to target immobilisation level 1000RU. ACE2 protein binding to SARS-CoV-2-RBD was analysed at 25ºC using multi-cycle injections of sACE2, ACE2-Fc and ACE2-Fc-TD at 8 concentrations between 1.56 – 200nM at 30µL/min for 180s, followed by 480s dissociation time. The surface was regenerated after each antibody injection using 1M NaCl/50mM NaOH at 30µL/min for 20s contact time followed by 120s stabilisation time. Flow cell 1 was used as a reference and so did not contain any captured SARS-CoV-2-RBD and was subtracted from all sensograms before analysis. Data were fitted to a 1:1 kinetics model using Biacore T200 Evaluation Software version 2.0.
ELISA
All ELISAs were carried out in triplicate wells. Direct ELISAs with ACE2 proteins were carried out with SARS-CoV-2 spike RBD-coated ELISA plates and 100ml of SARS-CoV-2 RBD protein (2mg/ml in PBS, pH 7.4) was added to each well and incubated overnight at 4°C, along with a control well with 100ul of PBS. The wells were washed three times with PBS containing 0.05% Tween-20 and blocked with 150ml 5% BSA in PBS by incubating for 4 hours at room temperature. Excess BSA was removed by washing twice with PBS containing 0.05% Tween-20. A range of ACE2 samples 0-3000pM in PBS containing 0.05% Tween-20 were made and 100ml added to each well and incubated at 4°C overnight. The plates were washed again four times with PBS containing 0.05% Tween-20 before addition of 100ml of detection antibody (anti-IgG-horse radish peroxidase (HRP, Cell Signalling) diluted in 1: 4000 1% BSA in PBS to each well and incubate for 2 hours at room temperature. The wells were washed four times with PBS containing 0.05% Tween-20 followed by the addition of 25ml tetramethyl benzidine (TMB; ThermoFisher) and incubate for 20min at room temperature. Reactions were stopped by addition 25ml of 3M HCl and absorbance read at 450nm.
Direct ELISAs of anti-SARS-CoV2 spike protein binding antibodies. ELISA wells were coated with 200ng/well SARS-CoV-2 RBD protein and detection with anti-SARS-CoV-2 RBD antibodies added in PBS containing 0.05% Tween-20 (range 0-3000pM). Development and signal detection as for the ACE2 direct ELISA except using an HRP-conjugated anti-His antibody.
Sandwich ELISA detection of anti-SARS-CoV-2 spike protein. ACE2-IgG-TD coated ELISA wells (300ng/well as the capture protein in 100ml) were prepared by adding ACE2-IgG-TD protein in PBS, pH 7.4 to each well and incubating at 4°C overnight. After washing the wells three times with PBS containing 0.05% Tween-20 and blocking with 150ml 5% BSA in PBS by incubating for 4 hours at room temperature and rewashing with PBS containing 0.05% Tween-20. Diluted SARS-CoV-2 RBD samples in PBS containing 0.05% Tween-20 (range 0-300nM) were added in 4-fold serial dilutions and incubated overnight at 4°C. The captured RBD was detected using anti-spike antibodies at 1nM in PBS containing 0.05% Tween-20 and incubating for 3 hours at room temperature. Following four washes with PBS containing 0.05% Tween-20, bound antibody was detected by adding to each well 100ml of anti-His-HRP antibody diluted in 1% BSA in PBS (1:4000) and incubating for 2hours at room temperature. The wells were finally washed four times with PBS containing 0.05% Tween-20, 25ml of TMB was added, incubated for 20min at room temperature, the reaction stopped by adding 25ml of 3M HCl and reading the absorbance at 450nm.
SARS-CoV-2 lentiviral pseudotyped virus neutralisation assay
SARS-CoV-2 pseudotyped lentivirus was produced by a three-plasmid transfection of HEK293T/17 cells following a similar approach to that previously described 29. Briefly, 24 hours prior to transfection cells were seeded within a 10cm dish before transfecting with plasmids encoding the HIV-1 gag-pol genes (p8.91) 30, a firefly luciferase reporter gene (pCSFLW) and the SARS-CoV-2 Spike gene (pCAGGS SARS-CoV-2-Spike) at a ratio of 1:1.5:1 ug using Fugene-HD (Promega) transfection reagent. Following overnight incubation, culture media was replenished. Supernatant was harvested at 48 and 72hrs post-transfection, and stored at -80oC. Neutralizing activity was measured by preparing two-fold serial dilutions of antibodies and incubating with 200 TCID50 of SARS-CoV-2 lentiviral pseudotyped virus for 1 hour at 37oC. HEK293T/17 cells stably expressing ACE-2 and TMPRSS2 were used as target cells, seeding 20,000 cells/well within a 96-well plate and incubating for at least 2 hours at 37 oC, 5% CO2 before use. Following incubation, the antibody and pseudotyped virus mix was transferred to the target cells and incubated for a further 60 hours at 37 oC, 5% CO2. Results were acquired by detection of luciferase expression using the Promega Bright-Glo assay system and GloMax Navigator plate reader, following manufacturer’s instructions. Data were normalised to untreated, transduced cells and uninfected cells as controls to determine percentage neutralisation and non-linear regression analysis performed within GraphPad Prism, interpolating IC50 values.
SARS-CoV-2 virus and cell lines
SARS-CoV-2 strain used for this study was originally isolated as described previously 8. Virus was propagated and titrated in African Green monkey cell line Vero-E6 (ATCC CRL-1586) by tissue culture infectious doses per milliliter (TCID50) method as described 31. Vero-E6 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM, Thermofisher) supplemented with 1% Non-Essential Amino-Acid (Thermofisher), 10mM HEPES (Thermofisher) and 10% FBS at 37C, 5% CO2.
SARS-CoV-2 infection of Vero E6 cells and quantification of viral RNA
The protocols for SARS-CoV-2 virus neutralization are based on a previous publication 8. Before cell infections, ACE2-Fc (dimeric for ACE2) or ACE2-Fc-TD (tetrameric for ACE2) purified proteins were mixed with SARS-CoV-2 virus (for multiplicity of infection of one) and incubated at 370C for 1 hour. Vero E6 cells were previously seeded into 48-well plates at a density of (5 x 104 cells per well) and after 24 hours, cells were either mock infected or infected with SARS-CoV-2/ACE2 protein mixtures. The cells were incubated for 15 hours at 370C before harvesting for quantitative real time polymerase reaction (qRT-PCR) analysis. Total cell RNA was extracted using Direct-zol RNA MiniPrep kit (Zymo Research) and the qRT-PCR was performed using the primers and probe specific for SARS-CoV-2 E-gene.
Forward primer: 50-ACAGGTACGTTAATAGTTAATAGCGT-30
Reverse primer: 50-ATATTGCAGCAGTACGCACACA-30
Probe: ACACTAGCCATCCTTACTGCGCTTCG
Intracellular viral RNA levels were normalized to 18S rRNA using the Taqman probe (Thermo Fisher Hs03003631-g1).