Cell culture and mitochondria transfer
Sprague-Dawley rat BMSCs were purchased from Cyagen Biosciences (Guangzhou, China). Cells were cultured in α-MEM (Hyclone SH30265.01B) supplemented with 10% (v/v) Fetal bovine serum (FBS) (Gibco 10099141) and 1% (v/v) Penicillin-Streptomycin solution (Gibco 15140122). Cells were cultured in a 37℃, 5% CO2 incubator with a humidity level of 90-95%. The culture medium was refreshed every 1 to 2 days. All cells utilized in experiments were between passage 4-7 (except for the senescence-associated β-galactosidase staining assay). Cellular and mitochondrial exposure to EDTA were avoided at all steps in the experiments. For mitochondria transfer, both donor and recipient BMSCs were seeded into a 6-well plate at 2×105 cells per well, with donor BMSCs being harvested after 36 hours. The Mitochondria Isolation Kit for Cultured Cells (ThermoFisher, Rockford, Illinois, USA) was utilized to isolate mitochondria from donor BMSCs according to the manufacturer’s instruction. A series of differential centrifugation steps were carried out to separate the mitochondrial and cytosolic fractions. Isolated mitochondria were directly resuspended in 1 mL of complete medium and kept on ice before transfer. The supernatant of the recipient BMSCs was removed, and the mitochondria suspension was added slowly-close to the bottom of the well. As for control BMSCs, the supernatant was also removed, and 1 mL of medium without mitochondria was added instead. The whole plate was centrifuged at 1,500 rcf at 4℃ for 15 minutes, placed within a 37℃ incubator for 2 hours, and centrifuged under the same conditions again, in order to facilitate cellular mitochondria uptake. The cells were then placed back into a 37℃ incubator for 24 hours before subsequent experiments.
Laser scanning confocal microscopy
For validation, MitoTracker® Deep Red FM (absorption/emission~644/665 nm) was utilized at a concentration of 500 nM, to label mitochondria of donor MSCs before isolation. Samples were then fixed with 4% (w/v) paraformaldehyde for 15 minutes, prior to examination under a laser confocal microscope (Leica). EDTA-free trypsin was utilized in all experiments in order to prevent membrane damage and MitoTracker leakage.
Flow Cytometry
For quantitative validation, MitoTracker® Green FM (absorption/emission ~ 490/516 nm) was utilized at a concentration of 100 nM to label mitochondria in donor MSCs before isolation. Quantification of mitochondria was carried out by using a BD FACSAria™ III (Becton Dickinson, Franklin Lakes, NJ, USA) flow cytometer, with at least 10,000 events for each sample and analysis being carried out with the BD FACSDivaTM software. Readings (in duplicates) for mean fluorescence intensity (MFI) in the FITC emission region were recorded, and regression analysis was performed with GraphPad Prism 6.01.
Proliferation curve and CCK8 assay
To construct the proliferation curve, control and recipient BMSCs were seeded at a density of 1×105 cells per well of a 6-well plate, 24 hours after mitochondria transfer. Then, the plate was placed into the Live Cell Imaging System, with images of each well being captured every 2 hours. The cell confluency of each image was calculated with IncuCyte software. For the CCK8 proliferation assay, BMSCs (1×105 cells per well) were seeded in 12-well plates, and then incubated at 37 °C with 5% CO2. After 48 hours, the medium was replaced with culture medium containing 10% (v/v) CCK8 kit (Dojindo, Shanghai China) solution, followed by incubation at 37 °C for an additional 2 h. The supernatant was then placed into a 96 well-plate, and the absorbance was then measured using a microplate reader at 450 nm, with 3 replicates per group.
Cell cycle analysis
Modulation of the cell cycle was analysed at 24 hours after mitochondria transfer. After trypsinization and rinsing with PBS, the cells were fixed in 70% (v/v) ethanol and incubated on ice for 15 min. Then, the cells were labeled with propidium iodide (PI)/RNase staining solution (#4087, Cell Signaling Technology, The Netherlands) and incubated at room temperature for 15 min. Cells were analyzed using BD FACSAria™ III (Becton Dickinson, NJ, USA). Data analysis was performed using FlowJo 7.6. Histograms were constructed with GraphPad Prism 6.01.
Immunofluorescence analysis
Samples were rinsed with phosphate-buffered saline (PBS) and fixed in 4% (w/v) paraformaldehyde for 15 minutes. After fixation, we washed the samples three times with PBS for 5 minutes each time. Then, samples were permeabilized with 0.1% (w/v) Triton X-100 (diluted with PBS) for 10 minutes and blocked with 3% (w/v) bovine serum albumin (BSA; diluted with PBS) for 1 hour to minimize non-specific staining. After removal of the permeabilization solution, samples were rinsed and washed with PBS again. The above procedures were carried out at room temperature. Samples were then incubated with the primary antibody - Rabbit Anti-Ki67 antibody (1:250; ab16667; abcam) in 3% (w/v) BSA overnight at 4 °C. After thorough rinsing with PBS to remove excess antibodies, the cells were incubated with Goat Anti-Rabbit IgG H&L (Alexa Fluor® 488) pre-adsorbed secondary antibody (2μg/ml; ab150081; abcam) for 1 hour in darkness. 4',6-Diamidino-2-phenylindole (DAPI; Sigma) was used to stain cellular nuclei. Images of three random fields of vision were captured with a confocal laser scanning microscope (Leica). Ki67-positive cells in each group (n=3) were quantified with Image-Pro-Plus, and GraphPad Prism 6.01 was used for statistical analysis.
Senescence associated β-galactosidase staining
Expression of senescence-associated β-galactosidase (SA-b-gal) activity was evaluated in different passages of BMSC using the SA-b-gal staining kit (Beyotime, Shanghai, China). Recipient and control BMSCs at passage 6 to 9, were seeded in a 6-well plate at 20×105 cells per well. When cells reached 90% confluence, the medium was discarded, and the cells were rinsed with PBS once, prior to fixing with 4% (w/v) paraformaldehyde for 15 minutes, and subsequent rinsing with PBS for a further three times. Then 1 mL of working solution was added to the plate, which was maintained at 37°C overnight away from light. The senescent cells in each group (n=3) were observed under an optical microscope and images from three random fields of vision were captured. The Image-Pro-Plus software was used for cell counting, and GraphPad Prism 6.01 was used for statistical analysis.
CyQUANT™ cell proliferation assay
BMSCs were seeded onto a 24 well glass-bottom plate with 4×104 cells per well in 3 replicates. The cells were incubated for 4 hours to allow adhesion prior to staining with the CyQUANT® NF Cell Proliferation Assay Kit (Invitrogen, USA) for another 30 minutes. We quantified the positively-stained cells within each group (n=3) from three random fields of vision under fluorescence microscopy. The Image-Pro-Plus software was used for cell counting, while GraphPad Prism 6.01 was used for statistical analysis.
Vertical migration test, scratch wound healing, and cell tracking
Vertical migration assays were performed in 6.5 mm Transwell® with 8.0 µm Pore Polycarbonate Membrane Inserts (Corning, NY, USA). About 8,000 cells (suspended in 200 µl/well) were seeded into the upper chambers in α‐MEM without FBS, with the lower chamber containing 600 µl of complete α‐MEM (10% v/v FBS). After 6 hours, cells that have migrated to the bottom layer were washed and fixed with 4% (w/v) paraformaldehyde for 15 minutes, while cells remaining in the upper chamber were removed. The chambers were then immersed into 0.05% (w/v) crystal violet dyes to stain cells at the bottom. 5 micrographs were taken for each chamber and the cell number (3 replicate readings per group) were counted manually and statistical analysis as then performed using the GraphPad Prism 6.01 software. Both scratch wound healing and cell tracking assays were carried out with the Cell IQ live cell kinetic imaging & quantification system (CM technologies, Colorado, USA). For the scratch wound‐healing assay, cells were seeded at a density of 2×105 cells/well (in 24‐well plates), and a scratch was made on the cell monolayer 12 hours later. After being washed three times with serum‐free medium, the cells were placed into the Cell IQ system and observed for another 24 hours. For cell tracking, the cells were seeded at 3,000 cells/well (in 24‐well plates) for 5 hours, prior to being transferred into the Cell IQ system. All wells were imaged every 10 minutes. The images were analyzed using a Cell IQ Analyzer. To avoid the effects of proliferation, serum-free culture medium was used in the scratch wound healing and cell tracking assays. Cell migration was expressed as follows - new scratch width/initial scratch width × 100%.
Alkaline phosphatase (ALP) and Alizarin Red S staining
Osteogenic induction was carried out by culturing cells in osteogenic differentiation medium (Cyagen Biosciences) containing 10% (v/v) FBS, 1% (v/v) Penicillin-Streptomycin, 2mM L-Glutamine, 50μM Ascorbate, 10mM β-Glycerophosphate, and 100nM Dexamethasone. The culture medium was changed every 2-3 days. The BMSCs were induced in the osteogenic differentiation medium for 4, 7, and 14 days. The cells were then washed twice in PBS, fixed with 4% (w/v) paraformaldehyde for 15 minutes and then stained with alkaline phosphatase (ALP) staining solution (A059-2-2, Nanjing Jiancheng Bioengineering Institute, Nanjing, China), after 4 and 7 days of induction, according to the manufacturer’s instructions. Measurement of ALP activity was performed with an Alkaline Phosphatase Assay Kit (Beyotime, Shanghai, China) following the manufacturer’s instructions (n=3). Alizarin red S staining was carried out after 14 days of induction. After fixing with ice-cold 70% (v/v) ethanol, each well was treated with 1 mL of freshly prepared 3% (w/v) alizarin red S solution (Sigma-Aldrich, Missouri, USA) , and incubated in the dark for 30 minutes. For quantitative analysis, three replicate absorbance readings for each group was measured at 595 nm following destaining with 10% (v/v) cetylpyridinium chloride monohydrate (Sigma-Aldrich) for 20 minutes.
Real-time quantitative RT-PCR analysis
Total RNA extraction was carried out using Trizol Reagent (Invitrogen, USA) according to the manufacturer's instructions. Amplifications were then performed with the different primers. The quality and quantity of the RNA obtained were subjected to spectrophotometric analysis using a bio-photometer (Thermo Scientific™ NanoDrop8000). The RNA was then reversed-transcribed into complementary DNA (cDNA) using a Reverse Transcription kit (Takara Bio Inc., Japan). Quantitative real-time polymerase chain reaction (qPCR) was performed with the SYBR Green PCR reagent kit (Roche, Germany) on an ABI QuantStudio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The primer sequences are listed in Table 1. All values were normalized to GAPDH.
Table 1. Primer sequences used for quantitative real-time PCR analysis.
Gene
|
Forward sequence (5′-3′)
|
Reward sequence (5′-3′)
|
GAPDH
|
GGGTCGGTGTGAACGGATTTGG
|
GCCGTGGGTAGAGTCATACTGGAAC
|
C-Myc
|
AACCCGACAGTCACGACGATG
|
GCTCTGCTGTTGCTGGTGATAG
|
Runx2
|
GAGATTTGTAGGCCGGAGCG
|
CCCTAAATCACTGAGGCGGT
|
BMP2
|
TGCTCAGCTTCCATCACGAAG
|
TCTGGAGCTCTGCAGATGTGA
|
Western blot analysis
The cultured cells were lysed with RIPA lysis buffer (Beyotime, Shanghai, China) supplemented with protease inhibitor cocktail (ThermoFisher, Rockford, Illinois, USA) on ice. The protein concentration was quantified using a BCA protein assay kit (Beyotime). 6×SDS Sample Loading Buffer (P0015F; Beyotime) was added to the protein before heating at 100℃ for 5 minutes. Then, the total protein extract (30 μg) was separated by 10% (w/v) sodium dodecylsulfate polyacrylamide gel electrophoresis, and proteins were transferred to a PVDF membrane. The membranes were blocked by 5% (w/v) skimmed milk and incubated with the primary antibody at 4 ℃ overnight, followed by incubation with a secondary antibody conjugated with horseradish peroxidase (HRP). Autoradiography was performed with an eECL Western Blot Kit (CoWin Bio., Jiangsu, China) on a film exposure machine. The primary antibodies C-Myc (ab39688), Runx2 (ab23981) and BMP2 (ab14933) were purchased from Abcam. The primary antibody against β-Actin (AF0003) and secondary antibody HRP-labeled IgG (A0208, A0216) were purchased from Beyotime, China. β-Actin was utilized as the protein loading control. The protein expression levels were normalized to β-Actin.
Cell aerobic metabolism measurements
Measurement of OXPHOS activity
Cells were trypsinized and seeded on a SeaHorse® 24-well XF-24 plate at a density of about 10,000 per well in XF base medium supplemented with 1g/L glucose, 1mM sodium pyruvate and 2mM glutamine, and were then placed into a SeaHorse XF Extracellular 24 Flux Analyzer, in order to measure their oxygen consumption rate (OCR). Mitochondrial respiration inhibitors - 1.0 μM oligomycin, 1.0 μM carbonyl cyanid-4 phenylhydrazone (FCCP), 0.5 μM antimycin A and rotenone - were used to treat the cells in the system, and OCR was measured before and after treatment with the inhibitors, for determination of basal respiration, ATP production, maximal respiration, and spare respiratory capacity. All results were normalized to the number of cells per well, counted immediately after detection.
Measurement of ATP production
Measurement of ATP production was performed on 10,000 cells per group using the ATPlite luminescent detection assay (Perkin Elmer), according to the manufacturer’s instructions. Measurements were expressed as Relative Luciferase Units (RLU) and calculated as fold of RLU, as measured in the control group.
Animal Experiments
Animals and Surgical Procedures
Forty 7-week-old male Sprague Dawley (SD) rats were used in this study. The experimental protocol was approved by the Animal Care and Use Committee of Peking University. To establish the cranial defect model, the dorsal cranium was surgically exposed after the rats were anesthetized by phenobarbital sodium (100mg/kg) via intraperitoneal injections. Two critical-sized full thickness bone defects (5 mm in diameter) on each side of the parietal bone were performed by a saline-cooled trephine drill. There were four groups (n = 5): Blank - without any implantation; NC (negative control), both sides filled with Matrigel only; Control - both sides filled with Matrigel and 5×105 control BMSCs for each defect; Treatment - both sides filled with Matrigel and 5×105 BMSCs after mitochondria transfer.
Micro-CT Scanning Evaluation
At 4- and 8-weeks post implantation, calvaria samples were harvested and fixed in 4% (w/v) paraformaldehyde for 24h at room temperature. The specimens were then examined using Viva40 micro-CT scanner (Scanco Medical. AG®). Bone volume were analyzed, and 3D reconstruction were built based on the processed images using Scanco® software.
Histological Analysis
Following Micro-CT analysis, rat skulls were decalcified and paraffin embedded. Histomorphology analysis was performed on 5 µm thick histology sections of the central portion of the skull defect. The sections were then subjected to hematoxylin and eosin (H&E) and Masson’s trichrome staining, according to the manufacturer’s protocols. Images were captured using an Olympus D70 camera mounted on a Nikon Eclipse E800 microscope.