Nanoparticle mediated killing of bacteria is known to be associated with ROS generation, leading to alteration of membrane structure and function, causing cellular stress and cell death[21]. Therefore, ROS production within the AuNPs-SL treated V. cholerae cells was measured using oxidative stress sensitive probe H2DCFDA. AuNPs-SL treated (treatment range 10–25 µg/ml) cells exhibited dose dependent increase in ROS production ranging from 2.5 to 20 fold (Fig. 1A). However, different ROS scavengers showed varied ROS quenching potential (Fig. 1B). The magnitude of ROS scavenging capacity was highest with N-acetyl-L-cysteine (NAC) followed by tiron (Tr), ascorbate (all ~ 5–6 fold), thiourea (TU), and sodium pyruvate (SP) (both ~ 3 fold). The Tr, TU, and SP scavenge •O2, H2O2, and •OH radicals, respectively. These results strongly suggest that the treatment of AuNPs-SL leads to the generation of at least three different ROS species. Nevertheless, the presence of different scavenging agents in the growth medium could rescue the growth of the V. cholerae treated with AuNPs-SL (Fig. 1C). However, the effect of ascorbate and SP was not sufficient for the rescue of growth of the cells from the effect of ROS.
NAC mediated scavenging of free radicals is mediated by increased intracellular glutathione level[22]. However, the reduction of ROS concentration by NAC is exhibited through a thiol-disulphide[23] exchange which may be responsible for this function. Although ascorbate and SP exhibit significant ROS scavenging effect, neither of the compounds were able to rescue the growth of the dying cells. (Fig. 1B and 1C) Similar phenomena were observed with cells treated with silver nanoparticles[24]. This result also infers that the nanoparticles also interact with the respiratory enzymes the function of which are rescues after NAC supplement.
Effect of DTT on AuNPs-SL treated cells
DTT, a strong reducing agent, has been reported to rescue cells from oxidative stress and restore their growth[25]. The effect of DTT on ROS generation in AuNPs-SL treated V. cholerae was checked by adding the compound in the culture medium. The treatment with DTT rescued the cells from ROS mediated oxidative stress generated in presence of AuNPs-SL (supplementary Fig. 1A). However, the presence of DTT could not stop the alteration in membrane potential due to AuNPs-SL treatment (supplementary Fig. 1B). In contradiction to the observation made by Wang et al., 2017.,[26], in our study, the addition of salicylate with DTT was unable to recuperate the membrane potential of the AuNPs-SL treated cells. However, the exact mechanism leading to this effect remains obscure. When the cells were cultured in LB agar plate containing AuNPs-SL (25–100 µg/ml), no growth was observed. However, the growth of the cells was rescued when treated cells were supplemented with DTT (Supplementary Fig. 1C). The possibility of structural alteration or aggregation of AuNPs-SL in presence of DTT was ruled out by incubating nanoparticles with DTT for a certain time interval. No significant alteration in the UV spectra was observed in nanoparticles incubated with DTT (Supplementary Fig. 1D).
Treatment of V. cholerae with AuNPs-SL leads to membrane depolarization
Oxidative stress leads to the alteration of membrane potential. The alteration of membrane potential in V. cholerae was measured in presence of various concentrations of AuNPs-SL using two different dyes, DiBAC4 and DiOC2. DiBAC4 is an anionic lipophilic bis-oxonol dye. During membrane depolarization, as the membrane potential shifts from negative towards positive, the concentration of the dye entering the cells also increases (i.e., the higher the membrane is depolarized, more is the oxonol fluorescence intensity). In our experimental setup, when the V. cholerae cells were treated with 10 and 25 µg/ml AuNPs-SL, membrane depolarization was increased by 13% and 16%, respectively (Fig. 2A & B). In addition, the V. cholerae cells treated with AuNPs-SL exhibited concentration dependent change in fluorescence intensity of DiOC2 (Fig. 2C & D), where, the change in fluorescence intensity of DiOC2 is directly proportional to loss of membrane potential of the cells [27] .
Effect of AuNPs-SL on the stress response gene of the V. cholerae
V. cholerae treated with AuNPs-SL undergo oxidative stress due to ROS generation within the cell. ROSs, including •O2, H2O2, and •OH are highly toxic and cause damage to the cells. Microorganisms respond to the higher level of cellular ROS concentration by triggering the multigenic response. Therefore, the expression profile of several selected genes was checked in the AuNPs-SL treated cells using qRT-PCR (Fig. 3). The genes used in the study and their respective primers are enlisted in Table 1.
Table 1
List of primers used in the RT-qPCR
Primers | | Sequence 5ʹ-3ʹ | Tm (°C) | Amplified product size (bp) |
dps | F | TGCACAGCTTTAGCGGTTAC | 55.96 | 119 |
R | TTGTTGGTGGAGCAGAATGC | 56.11 |
oxyR | F | GCACTTATTGTTGCGCGAAG | 55.95 | 123 |
R | CCCACCACATAGCTCTCCAT | 55.86 |
grx | F | TACCGCTTATGCAACGCAAA | 55.95 | 110 |
R | TTCCAGCCGATCATCAAACG | 55.74 |
gsp | F | GCTCTCTCAAGCGGAGTTTG | 56.06 | 121 |
R | TTCCGCCAGTGAGAAGAAGT | 55.98 |
luxO | F | ACTGCGGGTCACAGTGAATA | 56.06 | 135 |
R | GAGTCAATGGTGCGGTACAC | 56.05 |
katE, | F | GGTGATTAAGGCCGCACAAA | 56.19 | 112 |
R | AGCCATTTGCTGCCAATCTT | 55.74 |
ompU | F | CGGTGACAAAGCAGGTTCAA | 56.07 | 120 |
R | CGTACGCGAGAGTTGTCTTG | 56.23 |
recA | F | GGGCGTGAATATCGATGAGC | 56.07 | 102 |
R | ATGACATCCACAGCACCAGA | 56.02 |
sodA | F | GTGAACACCTTTGGCTCTGG | 56.13 | 106 |
R | CGGCAACCACATCCATCAAT | 55.96 |
soxR | F | GAAGGTCTCAGCGTTGCATT | 55.94 | 140 |
R | AGGTCAGTCCGACCATTTGT | 55.95 |
fur | F | ACAGCCAGAGTGCCAACATA | 56.32 | 130 |
R | ACGAGTCACGATACCAGCAT | 55.96 |
luxR | F | GATCCAAACCGCTCAGCATT | 55.98 | 139 |
R | TGGCGTTACGCAAGTGATTT | 55.82 |
The sodA being a part of the cellular defense system during oxidative stress, is involved in the conversion of superoxide anion (ꜘ•O2) to O2 and H2O2 that ultimately gets reduced to H2O by catalase [28]. We have observed ~ 5 fold increase in sodA expression in AuNPs-SL treated cells. The expression of sodA is controlled by soxSR regulon, which is also involved in the regulation of expression of more than 40 other genes. Excess superoxide radicals trigger the activation of soxSR regulons like soxR. The oxidized form of soxR acts as a transcription activator of sodA [29].
We have also observed ~ 4 fold upregulation in the expression of oxyR (a ROS-sensing transcriptional regulator). The oxyR is a master regulator mediating cellular response to the higher concentration of H2O2 within the cells. The oxyR mediated regulation of katE is well studied in Gram (–ve) bacteria [30] [31].. An increase in intracellular H2O2 level triggers the expression of oxyR regulon including catalase. Therefore, in AuNPs-SL treated cells, the expression level of hydroxyl peroxidase (katE) was also elevated; probably, to mitigate the oxidative damage caused by the H2O2.
The oxyR is an H2O2 scavenging LysR family protein, regulated with an N-terminal helix-turn-helix DNA binding domain. In presence of H2O2 oxyR changes to rearrange its secondary structure by forming an intramolecular disulfide bond resulting in the oxidized form of oxyR, which binds to its target site to execute its regulatory function. It can alter the expression of several genes including the H2O2 detoxification gene (katE), genes for FeS-centre repair, iron transport and sequestration (fur), and Mn import.
Further, the DNA binding protein (dps) has shown an increased expression of ~ 2.5 fold due to AuNPs-SL treatment to the cells. The expression of dps, is known to be involved in ROS resistance during the exponential growth phase and is regulated by oxyR. Nonspecific DNA binding of dps protects DNA against damage from ROS and the physical association of DNA with the toxic combination of Fe2 and H2O2. In E. coli, dps is also involved in tolerance to acid stress Fe[32] and Cu toxicity [33] [34] The increased expression of dps is involved with ameliorating the ROS damage in oxyR dependent manner[30] [35]. The global regulator of iron homeostasis, ferric uptake regulator (fur), mediates the oxidative stress defense mechanism [36] in V. cholerae. We have observed two fold upregulation in fur expression, indicating perturbation in the iron uptake and homeostasis within the AuNPs-SL treated cells. An overexpression of 5–6 fold of grx was also observed within the treated cells.
The ompU plays a critical role during the adhesion of V. cholerae to the host[37], which was down regulated in the AuNPs-SL treated cells. In the case of bacteria, outer membrane proteins play an important role in adaptation to the external environment. In Vibrio sp., the OmpU is a major porin involved in the adhesion/colonization of the bacteria. It helps to confer resistance to the microbes against antimicrobial peptides (AMPs) and bile toxicity in the host. Though, under iron limited condition, downregulation of the expression of the omps’, as the receptor of siderophore complex and heme-compound transporter have been observed in V. cholerae[38], down regulation of ompU under AuNPs-SL treated condition suggested alteration in iron transportation within the cells. Moreover, down regulation of ompU indicates impaired cell evasion and biofilm formation.
The luxO regulates multi-signal transduction system, was upregulated by seven folds indicating an increase in colonization tendency during oxidative stress in V. cholerae upon AuNPs-SL treatment. In V. cholerae, the gsp plays an important role in the secretion of secretory proteins, and proper outer membrane assembly (general secretion pathway), is required for the export of several proteins like chitin, cholera toxin, and protease [39] [40]. It also aids in the survival of V. cholerae under different stress conditions by facilitating biofilm formation, pathogenesis, the release of enterotoxin, biofilm dispersal, and membrane biogenesis[39]. AuNPs-SL treatment upregulated expression of gsp by three folds. Likewise, two-fold upregulation of recA was observed indicating ROS mediated SOS response in bacterial cells under stress conditions. The up regulation of the ROS responsive genes indicated AuNPs-SL treatment leads to the perturbation of several cellular and physiological functions and leading to the killing of V. cholerae cells.
AuNPs-SL treatment of V. cholerae alters metal ion concentration within the cells
For the maintenance of membrane potential, the cell requires the movement of ions across the cytoplasmic membrane. Consequent to the alteration of membrane potential due to AuNPs-SL treatment and subsequent gene expression profile prompted us to find the ion concentration within the V. cholerae cells. Sodium and potassium are the major regulatory ions for the maintenance of the membrane potential. Therefore, the concentration of major ions related to membrane potential and cellular stress physiology was checked by using ICP-MS. Treatment of V. cholerae with AuNPs-SL led to the increase in the K+, Na + and Fe2+ concentration inside the cells, whereas Ca2+ concentration remained unaltered (Table 2). Thus, the alteration of K + and Na + concentration supported the change in membrane potential and the alteration of Fe2+ concentration indicated disruption in iron homeostasis and related physiology within the AuNPs-SL treated cells.
Table 2
Ion concentration measurement under nanoparticles stress
Ions concentration (unit: mg/kg) | Control | AuNPs-SL-10 |
Iron | 146 | 229 |
Sodium | 2058 | 4076 |
Potassium | 2655 | 4434 |
Calcium | 1591 | 1583 |
Supplementation of Fe 2+ using Mohr’s salt rescue V. cholerae from AuNPs-SL stress
Iron is an essential micronutrient for the growth and metabolism of microorganisms, plays important role in ROS generation via Fenton reaction [41], and works as a cofactor for various enzymes viz. [Fe–S]-containing ferredoxins, heme-containing cytochromes, fumarases, etc[42]. In bacterial cells, iron uptake and storage are critically controlled and regulated by the cellular physiology and homeostatic mechanism. Since, the iron concentration increased within the cells due to AuNPs-SL treatment, we presumed that iron was not available for physiological functions. Therefore, the effect of external iron supplementation was checked in the V. cholerae in presence of AuNPs-SL. Growth kinetic studies revealed that the growth was rescued after iron supplementation to the growth medium via Mohr’s salt (Fig. 4A). In addition to that, Mohr’s salt supplementation significantly decreased the ROS production within the treated cells (Fig. 4B). Further, the growth of V. cholerae in Mohr’s salt supplemented agar plate indicated recovery of the cells from ROS stress. The supplementation of Mohr’s salt may have helped the cells in repairing the impairment of Fe-S cluster assemblies, an integral part of the electron transport chain (ETC), the impairment of which leads to the ROS generation[43]. Therefore, the cell regained their growth potential and viability.
AuNPs-SL treatment decrease ATP production and creates DNA damage in V. cholerae
The aforementioned impairment of iron clusters related to ETC and alteration in membrane potential in AuNPs-SL treated V. cholerae, prompted us to investigate the cellular ATP level. The process of ATP production requires maintenance of membrane potential and membrane integrity as well as proper function of the ETC. Using luciferase based ATP bioluminescence assay, we observed ~ 50% reduction in ATP synthesis in AuNPs-SL treated cells. However, no dose dependent decrease in ATP synthesis was observed in the treated range (10 and 25 µg/mL) of AuNPs-SL (Fig. 5A).
An increase in ROS level within the cells is known to damage DNA by creating lesions in bases, sugar, DNA protein cross links within the single and double strand bases of DNA. Overexpression of dps and recA, DNA protecting and damage repair elements, indicates considerable DNA damage within the AuNPs-SL treated cells. The TUNEL assay used for the estimation of DNA fragmentation measures fluorescence from the free 3′-OH of the damaged DNA, synthesized from fluorescein labeled dUTP by exogenously supplied terminal deoxynucleotidyl transferase. The incorporation of labeled dUTP increases fluorescence inside the cells. When the cells were treated with AuNPs-SL, we observed 20 fold increase in the fluorescence intensity (Fig. 5B) indicating severe DNA damage and fragmentation within cells in AuNPs-SL treated condition.
AuNPs-SL treatment leads to apoptosis in V. cholerae
DNA fragmentation is a hallmark of the initiation of programmed cell death or apoptosis. Therefore, we checked for the initiation of cellular apoptosis within the V. cholerae treated with AuNPs-SL by using Annexin V allophycocyanin conjugate. Figure 6A shows a significant shift in a population showing annexin affinity upon AuNPs-SL treatment. Around 5 fold increases in the fluorescence intensity of Annexin V have been observed within the treated cells (25 µg/mL of AuNPs-SL treatment); however, the effect of a lesser amount of AuNPs-SL (10 µg/mL) was not significant (Fig. 6B). Nevertheless, this result indicated the presence of a significant amount of apoptotic cellular population upon AuNPs-SL treatment.
AuNPs-SL treatment causes cell wall damage and membrane leakage in V. cholerae
The bactericidal activity of AuNPs-SL against V. cholerae suggests the interaction of the AuNPs-SL with the cell membrane. Therefore, the effect of the AuNPs-SL was checked on the outer surface and cell membrane of V. cholerae by TEM. Extensive damage of the outer surface with ruptured membrane was observed in the AuNPs-SL treated cells compared to the controlled one (Fig. 7A(i) and 7A(ii)). Damaged cell wall and membrane led to the outflow of cellular protein and DNA in the surrounding environment; therefore, we measured the amount of released protein and DNA from the cell. There was a significantly higher amount of release of cellular protein from the AuNPs-SL treated cells. We also observed a concentration-dependent release of protein and DNA with an increasing dose of AuNPs-SL (Fig. 7B and 7C). Treatment with 25 and 50 µg/ml of AuNPs-SL treatment of V. cholerae, resulted in a twofold and fourfold increase in DNA leakage respectively.