Clinical specimen and animal experiments
Clinical samples of paired adjacent and LUAD tissue specimens were the same ones obtained from our previous study [24]. The LUAD patients of cohort#1, #2 and #4 were recruited from Shanghai Chest Hospital of Shanghai Jiao Tong University (Shanghai, China) and the cohort#3 was recruited from Second Hospital of Shandong University (Jinan, Shandong province, China). Written informed consents were obtained from each enrolled patient according to the guidelines of the Declaration of Helsinki. The KrasG12Dand p53R172H (KP)-driven spontaneous LUAD mice models with or without overexpressing YTHDC2 were constructed as we previously reported [24]. KPE indicates an expression of empty vector, KPYWT indicates an expression of wild type (WT) YTHDC2 and KPE△YTH indicates an expression of YTHDC2 without the YTH domain. For xenograft experiments, 1.5×107 Dox-inducible YTHDC2-expressing H1299 cells were subcutaneously injected into 4-6-week-old athymic nude mice. At day 14 post inoculation, mice were randomly divided into 2 groups for further administrating with or without Dox (30 mg/kg) every other day. Tumors were assessed after sacrificing the mice at day 28 after implantation. The tumor volume was measured as 0.5 × L × W2, (L indicates tumor length, while W indicates tumor width). All experiments were approved by institutional ethics committee of Shanghai Chest Hospital.
Monolayer and 3 dimensional (3D) cell culture
Human embryonic kidney (HEK)-293T, human lung epithelial cell line BEAS-2B, bronchus epithelial cell line 16HBE, human LUAD cell lines NCI-H1299, NCI-H1975 and NCI-H441 were purchased from Cell Bank of the Chinese Academy of Science (Shanghai, China). Possible mycoplasma contamination of all the cell lines was excluded. For monolayer culture, cells were cultured in DMEM (GIBCO, Carlsbad, CA, USA) with 10% FBS (HyClone, Logan, UT, USA) and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA). For 3D culture, spheroids were generated in Cultrex® Basement Membrane Extract (BME)-based culture system, which is described previously [24].
Reagents and plasmids
For the reagents used in this study, Deferoxamine (DFO, 80 μM, #D9533), N-acetyl-cysteine (NAC, 1 mM, #A7250), and cycloheximide (CHX, 10 μg/ml, #C7698) were purchased from Sigma (St Louis, MO, USA). 3-Methyladenine (3-MA, 5 μM, #HY19312), Chloroquine (25 μM, #HY17589), Bortezomib (100 nM, #PS341), Actinomycin D (ActD, 5 μg/ml, #HY17559) were purchased from MedChemExpress (Monmouth, NJ, USA). Ferrostatin-1 (Fer-1, 1 μM, #S7243), Necrosulfonamide (0.5 μM, #8251), MG132 (50 μM, #S2619), Dox (#S4163) and Z-VAD-FMK (20 μM, #S7023) were purchased from Selleck (Houston, TX, USA). GSH (5 mM, #G8180), DEPC water (#R1600) and RNasin (#R8060, 5 U/μL) were purchased from Solarbio (Beijing, China). C11-BODIPY581/591 (5 μM, #D3861) was purchased from Invitrogen. The YTHDC2, YTHDC2ΔYTH, YTHDC2sg2-resistant (res), METTL3, METTL3-shRNA (sh), EXOSC10-single-guide (sg) RNA, XRN2-sg, YTHDC2-sg1, YTHDC2-sg2, ATG5-sg and siRNA targeting ATG7 were obtained from our previously studies [24, 34]. For crispr/cas9 knockout of SLC7A11 (guide RNA sequence: GATATCACAGCAGTAGCTGC), SLC3A2 (guide RNA sequence: GGCAGCCGCGGCTAAGTTCA) and HOXA13 (guide RNA sequence: GTACTGTTTGGAACAAGAGG) sgRNAs were cloned into the lentiCrisprV2 plasmids (Addgene, Cambridge, MA, USA). Lentiviral-based plasmids expressing POLR2L, SLC7A11 and SLC3A2 were purchased from Zuorun Biotech Ltd (Shanghai, China). Dox-inducible YTHDC2 and YTHDC2ΔYTH were constructed into the lentiviral based pLVX plasmids (BioVision Technology Ltd, Shanghai, China). The primer sequences were listed in Supplementary Table S1.
IB, ELISA, IHC and RT-qPCR
IB was performed conventionally. The primary antibodies used for IB were: anti-YTHDC2 (Abcam, #ab176846, #220160, Cambridge, MA, USA), anti-METTL3 (Abcam, #ab195352), anti-ATG5 (Abcam, #ab108327), anti-ATG7 (Cell Signaling Technology (CST), #8558S, Boston, MA, USA), anti-SLC7A11 (Abcam, #ab175186), anti-SLC3A2 (Abcam, #ab108300), anti-EXOSC10 (Abcam, #ab50558), anti-HOXA13 (Abcam, #ab172570), anti-XRN2 (Abcam, #ab72181), anti-HA (CST, #2367S) and anti-GAPDH (Abcam, #ab181602). The SLC3A2 and HOXA13 protein levels in tissues were also determined by ELISA kits from Lichen Biotech Ltd (Shanghai, China). The tissue microarray assay (TMA) was subjected into IHC using conventional protocols. IHC scores were calculated as we described previously [24]. The antibody used for IHC were: anti-SLC3A2 (Abcam, #ab108300), anti-HOXA13 (Abcam, #ab172570) and anti-4-hydroxynonenal (4-HNE) (Abcam, #ab48506). For RT-qPCR, total RNA was isolated using Trizol reagent (Invitrogen). cDNA was synthesized with RT-PCR Kit (Vazyme Biotech, #P611, Nanjing, China). The relative mRNA and RNA fragments expression level was quantified by qPCR with a SYBR Kit (Vazyme Biotech, #Q711) and was normalized to the data from GAPDH or IgG. The qPCR primers are listed in Supplementary Table S1.
Luciferase reporter assay
For the promoter study, truncated versions of the SLC3A2 promoter were cloned into the pGL4-basic plasmids (Promega, Madison, WI, USA). For the analysis of mRNA stability, partial 3’ untranslated region (3’UTR) of the HOXA13 mRNA was cloned into the pmir-GLO plasmids (Zuorun Biotech Ltd). For mutation of 3’ UTR, adenosine (A) in the m6A motif was replaced by a cytosine (C). The WT and mutant (Mut) PCR products were synthesised by Generay Biotech Ltd (Shanghai, China). Luciferase activity was detected by the dual luciferase reporter gene assay kit (Promega). The firefly luciferase activities were normalized to the Renilla luciferase activities. The primers used for reporter construction were listed in Supplementary Table S1.
MeRIP-seq, PAR-CLIP, RIP, RNA pull down assay
MeRIP-seq data were obtained from previous study and PAR-CLIP analysis was measured as previously described [24]. For RIP experiments, cell lysates were incubated with magnetic beads loaded with 5 μg antibodies overnight at 4 °C. RNA-protein mixture was then digested by proteinase K. The remaining RNA was finally measured by RT-qPCR with normalization to input. For RNA pull down, probes were synthesized with or without m6A modification at GGAC or mutant GGCC motifs. Briefly, the probes were labelled by biotin (Takara, Dalian, China). Incubated cell lysed with 3 μg biotinylated probes at 4°C overnight. Then biotin-coupled RNA-protein complex were pulled down using streptavidin magnetic beads (Life Technologies, Carlsbad, CA, USA). After washing, the streptavidin beads were boiled and analyzed for the IB analysis. The primer and probe sequences are supplied in Supplementary Table S1.
EMSA and ChIP
For EMSA, the WT and mut short oligonucleotide probes were synthesized by GenePharma (Shanghai, China). The probes sequences are listed in Supplementary Table S1. EMSA was performed using the gel shift kit (Promega). For the super shift assay, 0.5 μg, 1 μg, or 2 μg of the anti-HOXA13 (Abcam, #ab172570) antibody or IgG (CST, #3900) were added to the nuclear extracts, and incubated at RT for 10 min prior to the DNA binding reaction. All DNA-protein mixtures were resolved in electrophoresis on 5% native polyacrylamide. For ChIP, it was performed using a ChIP-IT ® Express kit (Active Motif, Cat #53008, Carlsbad, CA, USA) according to the manufacturer’s instructions. Protein-DNA complexes were incubated with anti-HOXA13 (Abcam, # ab172570) or IgG (CST, #3900) antibodies coupled protein G beads at 4°C overnight. After elution and reverse cross-link, DNA was purified for subsequent qPCR. The probes and primers used for EMSA and ChIP-qPCR were listed in Supplementary Table S1.
Fluorescence in situ hybridization (FISH)
Briefly, samples were deparaffinized, digested with proteinase K, prehybridized with prehybridization buffer for 1h at 37°C. Slides were incubated with specific Cy3-labeled probes for HOXA13 mRNA overnight. After washing 3 times with saline sodium citrate buffer, slides were incubated with anti-YTHDC2 antibody (Invitrogen, # PA5-67256) and fluorescent secondary antibody (CST, #4412) for 1h at RT. Finally, nuclei were counterstained with DAPI. All images were collected via a confocal microscope (Leica, wetzlar, German). The probes were listed in Supplementary Table S1.
Cell viability and cell death analysis
Cell viability was determined using the CellTilter-Glo cell viability assay (Promega, #G9682) according to manufacturer’s instructions. Cell death was measured by staining with SYTOX Green followed by flow cytometry.
Electron microscopic analysis
To observe the morphological change of mitochondria following induction of YTHDC2, H1299-iYTHDC2 cells were seeded onto 4-well chambered cover glass (Thermo Fisher Scientific, #155382, Waltham, MA, USA) at a density of 15,000 cells/well and treated with or without Dox for 24h. Images were captured using the Olympus EM208S transmission electron microscope (TEM, hitachi, Tokyo, Japan).
Measurement of lipid peroxidation
To detect lipid ROS, the cells were stained with 5 μM C11-BODIPY581/591 for 30 min at 37°C followed by microscopic or flow cytometric analysis. To visualize the membrane, cells were incubated with 25 μg/ml Concanavalin A-Alexa FluorTM 350 (Thermo Scientific, #C11254) following C11-BODIPY581/591 staining. Images were taken at emission at 580/600 nm (the non-oxidized form, red) and 490/510 nm (the oxidized form, green). To measure 4-HNE and malondialdehyde (MDA), kits from Abcam (#238538 and #118970) were used.
Bioinformatics
UALCAN was mined to predict the transcriptional expression of SLC3A2. The Kaplan-Meier plotter databases were used to analyze survival information in clinical LUAD patients. The statistics of correlation between SLC3A2 and YTHDC2 were carried out with Starbase database. The HOXA13 binding site within the SLC3A2 promoter was predicted by JASPAR and UCSC database.
Statistical analysis
GraphPad Prism 8 software was used for all statistical analyses. P values were calculated with t-test, one-way ANOVA, two-way ANOVA, pearson analysis and the Chi-squared test. Survival curves were generated using the Kaplan-Meier method and compared using the log-rank test. All the values are presented as means ± SEMs from three independent experiments. The indicated p values (*p < 0.05 and **p < 0.01) were considered statistically significant. N.S. means non-significance.