The mechanism by which tertiary lymphoid structures in tumours affect prognosis and immunotherapy in patients with hepatocellular carcinoma

doi:10.21203/rs.3.rs-1524888/v1

Background

Tertiary lymphoid structures (TLSs) are formed by the aggregation of tumour-infiltrating lymphocytes (TILs), which is driven by chemokines or cytokines in the tumour microenvironment. Studies have shown that TLSs are associated with good prognosis in patients with various solid tumours and can improve patient responses to immunotherapy. However, the role of TLSs in hepatocellular carcinoma (HCC) remains controversial, and the underlying molecular mechanism is unclear.

Methods

According to haematoxylin-eosin (HE) staining results, 150 HCC patients from Xijing Hospital were divided into TLS + and TLS- groups, and Kaplan–Meier (K-M) analysis was performed to assess their overall survival (OS) and recurrence-free survival (RFS). Spearman correlation analysis was used to calculate the correlation between LCK and TILs, and the molecular pathways of LCK regulating immunotherapy were clarified through enrichment analysis. Immune score was calculated based on the expression difference of LCK to evaluate the sensitivity of HCC patients to ICIs.

Results

The HE results showed that 61 (40.7%) of 150 HCC patients had TLSs, and 89 (59.3%) didn't. The K-M results showed that TLSs had no effect on the OS of HCC patients but significantly affected the RFS. Enrichment analysis showed that upregulation of LCK expression mainly regulated cytokine signalling pathway, the chemokine signalling pathway and T cell activation. Immune score showed that HCC patients with high expression of LCK had higher sensitivity to ICIs.

Conclusion

LCK may regulate the sensitivity of HCC patients to ICIs by affecting the related pathways of TLSs formation to improve the prognosis of patients.

tertiary lymphoid structures

hepatocellular carcinoma

LCK

immunotherapy

prognosis

In 2020, there were approximately 19.3 million new cancer cases worldwide, and liver cancer was the sixth most common and the third deadliest cancer^[1]. Approximately 50% of new cases and deaths occurred in China^[2]. Hepatocellular carcinoma (HCC) is the most common clinical type of liver cancer, accounting for 85–90% of cases^[3]. In recent years, the diagnosis and treatment of HCC have greatly improved, but the overall resection rate of HCC is low, and the postoperative recurrence and mortality rates are high, resulting in a 5-year survival rate of approximately 15% among HCC patients^{[4, 5]}. The high recurrence and mortality rates of HCC are the most difficult problems at present. With the clinical application of neoadjuvant therapy, the resection rate of HCC has increased, and the survival period of patients with advanced HCC has been significantly prolonged^[6]. However, the objective response rate (ORR) of HCC patients to immune checkpoint inhibitors (ICIs) and targeted drugs is low, which seriously limits the benefits of neoadjuvant therapy^[7]. The tumour microenvironment (TME), which comprises tumour cells, tumour-infiltrating lymphocytes (TILs), stromal cells, etc., is highly heterogeneous and promotes both tumour growth and immune tolerance, eventually leading to the immune escape of tumour cells^[8]. Therefore, TILs in the TME are considered to be the ultimate target of immunotherapy in HCC patients^[9].

Tertiary lymphoid structures (TLSs) are newly discovered immune structures that are formed by the aggregation of lymphocytes in patients with chronic infections, immune diseases and tumours, and TLSs have the ability to initiate immune responses^[10]. TLSs are mainly composed of CD3 + T cells, CD8 + T cells, CD20 + B cells, dendritic cells, macrophages and high endothelial venules, and TLSs can improve immune function and thus affect the prognosis of tumour patients^{[11, 12]}. TLSs can be divided into lymphocyte aggregates, round lymphocyte clusters without germinal centres, and follicles with germinal centres according to the degree of maturity^[13]. Germinal canters are sites of B-cell amplification, immunoglobulin class conversion, somatic hypermutation and affinity maturation, and the emergence of germinal centres can improve the prognosis of HCC patients^{[14, 15]}. Studies have shown that TLSs are associated with good prognosis in patients with gastric cancer^{[16, 17]}, colorectal cancer^{[18, 19]}, pancreatic cancer^[20], lung cancer^[11], bladder cancer^[21], breast cancer^[22], head and neck squamous cell carcinoma^[23] and melanoma^[24]. In addition, the ORRs of patients to targeted drugs and ICIs were better among tumour patients with TLSs than among tumour patients without TLSs^[25]. However, the function of TLSs in HCC patients is still controversial. For example, Finkin et al showed that para-tumour TLSs were associated with worse OS in HCC patients^[26]. However, Calderaro and Li found that TLSs were not associated with the OS of HCC patients but rather were associated with better RFS of HCC patients; however, the underlying mechanism remains unclear^{[15, 27]}.

The mechanism underlying the antitumour effect of TLSs may be the result of a combination of many components, including T-cell immunity, B-cell humoral immunity and DC antigen presentation, or the effect of a single component^[28]. The formation and function of TLSs are dependent on the recruitment of lymphocytes by CCL2, CCL-3, CCL-4, CCL-5, CCL-8, CCL-18, CCL-19, and CCL-21 and CXCL9, CXCL-10, CXCL-11, and CXCL-13^{[29, 30]}. Lymphocyte-specific protein tyrosine kinase (LCK) is a member of the Src family of protein tyrosine kinases^[31]. LCK is a key signalling molecule that functions in T-cell maturation, mediates T-cell metastasis and enhances the antitumour effects of T cells in response to stimulation by chemokines^[31–33]. In patients with nasopharyngeal carcinoma, LCK promotes tumour proliferation and increases drug resistanc^[34]. However, it remains unknown whether LCK mediates the formation of TLSs and thus affects the molecular mechanism underlying the efficacy of immunotherapy and targeted therapy in HCC patients. Therefore, we investigated 150 HCC patients from Xijing Hospital and public databases to investigate the mechanism of action of TLSs and LCK in regulating HCC responses to immunotherapy.

Patients

In this study, 150 HCC patients who underwent surgical resection at the Department of Hepatobiliary Surgery of Xijing Hospital were randomly selected for inclusion; all the HCC patients received surgical resection for the first time. The liver function, alpha-fetoprotein (AFP) level, tumour number, tumour diameter and pathological stage of HCC patients were assessed in the study. This study was approved by the Ethics Committee of Xijing Hospital (KY20202115-C-1) and was conducted in accordance with the criteria of the Declaration of Helsinki.

Real-time Quantitative Fluorescence PCR

RNA was extracted from the frozen tissues of 39 HCC patients. The expression levels of LCK and other genes in HCC tissues were measured by qRT–PCR. The primer sequences used for amplification are shown in Table 1.

Table 1

Primer sequences used in quantitative real-time polymerase chain reaction (qRT–PCR).
Genes	Forward (5'-3')	Reverse (5'-3')
LCK	CACGAAGGTGGCGGTGAAGA	GAAGGGGTCTTGAGAAAATCCA
CCL2	GCTCATAGCAGCCACCTCATTC	CCGCCAAAATAACCGATGTGATAC
CCL3	ATCATGAAGGTCTCCACCAC	TCTCAGGCATTCAGTTCCAG
CCL4	TGCTAGTAGCTGCCTTCTGC	TTCACTGGGATCAGCACAGAC
CCL5	CCAGCAGTCGTCTTTGTCAC	CTCTGGGTTGGCACACACTT
CCL8	TGGAGAGCTACACAAGAATCACC	TGGTCC AGATGCTTCATGGAA
CCL18	CTCTGCTGCCTCGTCTATACCT	CTTGGTTAGGAGGATGACACCT
CCL19	CTGCCTGTCTGTGACCCAGCGCCCC	ACTTCTTCAGTCTTCGGATGATGCG
CCL21	CCTTATCCTGGTTCTGGCCT	CAGCCTAAGCTTGGTTCCTG
CXCL9	ATGAGGATGAAAGTGGTGATTGG	GGTGTTGGTGTTGAATAGAAAGC
CXCL10	ATGAGGATGAAAGTGGTGATTGG	GGTGTTGGTGTTGAATAGAAAGC
CXCL11	GACGCTGTCTTTGCATAGGC	GGATTTAGGCATCGTTGTCCTTT
CXCL13	GCTTGAGGTGTAGATGTGTCC	CCCACGGGGCAAGATTTGAA
PD-L1	TGGCATTTGCTGAACGCATTT	TGCAGCCAGGTCTAATTGTTTT
PD-1	CCAGCCCCTGAAGGAGGA	GCCCATTCCGCTAGGAAAGA
CTLA4	GCCCTGCACTCTCCTGTTTTT	GGTTGCCGCACAGACTTCA
β-actin	CTCCATCCTGGCCTCGCTGT	GCTGTCACCTTCACCGTTCC

Haematoxylin-Eosin (HE) Staining

A total of 150 formalin-fixed paraffin-embedded HCC tissue samples were analysed by HE staining. The patients were divided into the TLS+ group and the TLS- group according to the presence or absence of TLSs observed in the HE results.

Immunofluorescence (IF) and Immunohistochemistry (IHC) Staining

IF and IHC were performed in the TLS+ group. The sum of CD20+ B cells, CD3+ T cells, CD8+ T cells and LAMP3+ DCs in all the TLSs in a 400x field was calculated. The TILs were divided into high and low count groups by drawing receiver operating characteristic (ROC) curves to calculate the cut-off value ((sensitivity + specificity) −1).

Downloading and Screening Data

The sequencing data and corresponding clinical data of HCC patients were downloaded from The Cancer Genome Atlas (TCGA) database. Excluding 40 patients who received antitumor therapy (except surgical resection), 331 patients were included in the study.

Screening of TLS-related molecules

We used LinkedOmics to download the relevant molecular data for the chemokines (CCL2, CCL-3, CCL-4, CCL-5, CCL-8, CCL-18, CCL-19, and CCL-21 and CXCL9, CXCL-10, CXCL-11, and CXCL-13). The molecules related to all 12 chemokines were selected, and LCK, whose expression was most highly correlated TIL numbers and was highest in HCC, was selected using the GEPIA and TIMER websites. Then, we used Xijing Hospital data to calculate the correlations between LCK expression and TIL numbers. In addition, TCGA data in the ACLBI (Assistant for Clinical Bioinformatics, https://www.aclbi.com/static/index.html#/) database were used to calculate the immune score of the different LCK expression groups to evaluate the impact of LCK expression on response to immunotherapy.

Enrichment Analysis

To study the molecular mechanisms by which LCK expression affects TLS formation and response to immunotherapy in HCC patients, TCGA data were used to perform Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses to explore the relevant molecular pathways. P<0.05 (namely, -log10>1.3) was considered statistically significant.

Half-maximal Inhibitory Concentration (IC50) Values

The IC50 is an important indicator for evaluating drug efficacy or sample response to treatment. Genomics of Drug Sensitivity in Cancer (GDSC) data were used to calculate differences in HCC patients' sensitivity to targeted drugs in the different LCK subgroups.

Survival Analysis

For all the above groups (TLS+ and TLS- groups, high and low TIL count groups and high and low LCK expression groups), Kaplan–Meier (K-M) survival analyses were performed. The log-rank test was used to compare survival differences among different groups, and Cox analysis was used to determine the independent prognostic factors of HCC patients. P<0.05 was considered statistically significant.

Statistical Analysis

Unpaired t tests were used to calculate significant differences in LCK expression between the TLS+ and TLS- groups with GraphPad Prism 6 Software. Cox analysis was used to determine the independent factors that affected the RFS of HCC patients. Survival differences were expressed by a K-M curve and analysed by log-rank tests. Spearman correlation analyses were also performed. Related R packages included "ggplot2", "stats", "pheatmap", "clusterProfiler" and "pRRophetic". P<0.05 was considered statistically significant.

Intratumoural TLS

According to the HE results, among the 150 HCC patients from Xijing Hospital, 61 patients (40.7%) were assigned to the TLS + group, and 89 patients (59.3%) were assigned to the TLS- group (Fig. 1). The K-M survival curve results showed that the presence of TLSs had no effect on the OS of HCC patients (Fig. 2A); however, the presence of TLSs was associated with good RFS (Fig. 2B), especially early RFS (within 2 years after HCC resection^[35]) (Fig. 2C), but had no effect on advanced RFS (Fig. 2D). Univariate Cox analysis showed that the presence of TLSs, aspartate transaminase (AST), lymph, alkaline phosphatase (ALP), albumin (ALB), tumour diameter, tumour capsule, cancer emboli, Child grade, American Joint Committee on Cancer (AJCC) stage and Barcelona Clinic Liver Cancer (BCLC) stage were significantly correlated with RFS. Multivariate Cox analysis showed that the presence of TLSs, AST, lymph, ALB, tumour capsule, Child grade and BCLC stage were independent prognostic factors of RFS (Table 2). Therefore, the presence of TLSs, as an independent protective factor for RFS, may be associated with longer RFS in HCC patients.

Table 2

Univariate and multivariate Cox regression analyses of risk factors associated with recurrence-free survival from the Xijing Hospital data.
Variable	Univariate analysis		Multivariate analysis
	HR (95% CI)	P value	HR (95% CI)	P value
Sex (male vs. female)	1.258 (0.621–2.547)	0.524
Age (> 60 vs. ≤60)	1.005 (0.587–1.720)	0.987
TLSs (positive vs. negative)	0.545 (0.321–0.926)	0.025	0.504 (0.291–0.875)	0.015
ALT, µ/L (> 50 vs. ≤50)	1.038 (0.627–1.720)	0.885
AST, µ/L (> 40 vs. ≤40)	1.974 (1.206–3.232)	0.007	1.874 (1.125–3.122)	0.016
HBsAg (positive vs. negative)	1.437 (0.802–2.577)	0.223
TBil, µmol/L (> 20.5 vs. ≤20.5)	1.033 (0.604–1.786)	0.905
AFP, ng/ml (> 400 vs. ≤400)	1.504 (0.913–2.478)	0.109
Liver cirrhosis (Yes vs. No)	1.179 (0.713–1.952)	0.521
Lymph, 10E9/L (> 1.1 vs. ≤1.1)	0.535 (0.319–0.899)	0.018	0.521 (0.299–0.909)	0.022
ALP, µ/L (> 125 vs. ≤125)	2.879 (1.741–4.760)	< 0.0001
ALB, g/L (> 40 vs. ≤40)	0.345 (0.207–0.576)	< 0.0001	0.382 (0.225–0.649)	< 0.0001
Tumour number (multiple vs. single)	1.743 (0.927–3.278)	0.085
Tumour diameter, cm (> 5 vs. ≤5)	2.369 (1.435–3.911)	0.001
Tumour capsule (Yes vs. No)	0.442 (0.270–0.724)	0.001	0.333 (0.198–0.562)	< 0.0001
Cell differentiation (healthy vs. poor/moderate)	0.623 (0.349–1.112)	0.109
Portal vein invasion (Yes vs. No)	1.889 (0.857–4.165)	0.115
Cancer emboli (Yes vs. No)	1.810 (1.065–3.075)	0.028
Child grade (B/C vs. A)	4.608 (1.664–12.760)	0.003	4.266 (1.465–12.421)	0.008
AJCC Stage (Ⅲ+Ⅳ vs. Ⅰ+Ⅱ)	2.384 (1.435–3.962)	0.001
BCLC Stage (B + C VS. 0 + A)	2.123 (1.289–3.495)	0.003	2.466 (1.458–4.170)	0.001
Notes: TLS, tertiary lymphoid structures; ALT, alanine aminotransferase; AST, aspartate transaminase; TBil, total bilirubin; AFP, alpha-fetoprotein; ALP, alkaline phosphatase; ALB, albumin.

TILs of Intra-TLS

To further show the protective effect of TLSs in HCC patients, the numbers of CD20+ B cells, CD3+ T cells, CD8+ T cells and LAMP3+ DCs in TLSs was observed by IF/IHC (Figure 3). The results showed that the numbers of CD20+ B cells and CD8+ T cells were significantly correlated with better OS in HCC patients (Figure 4A-B), while the numbers of CD3+ T cells and LAMP3+ DCs were not significantly correlated with OS (Figure 4C-D). However, both numbers were significantly correlated with the RFS of HCC patients (Figure 4E-H), and the greater the number was, the longer the RFS of HCC patients was. Moreover, the numbers of these cell populations had a strong predictive validity for the RFS of HCC patients (Figure 5), which may inform the clinical treatment of patients.

Molecular Mechanisms by which TLSs Regulate the Response to Immunotherapy

TLS-related Molecule Expression

The expression of a total of 88 molecules was positively correlated with the expression of 12 chemokines, with a correlation greater than 0.4 (moderate correlation) (Figure 6A). LCK, whose expression was most highly correlated with TIL numbers and was highest in HCC, was selected. Spearman correlation analysis was used to calculate the correlation between the expression of LCK and chemokines in the Xijing Hospital, TCGA and ICGC data (Figure 6B-D). In addition, the expression of LCK in the TLS+ group was significantly higher than that in the TLS- group (Figure 7A), and the OS of HCC patients in the high LCK expression group was significantly better than that in the low LCK expression group (Figure 7B).

Immunotherapy

To test the effect of LCK expression on the response to immunotherapy, TIMER was used to prove that LCK expression was positively correlated with the numbers of B cells, T cells, DCs, macrophages and neutrophils, and the Xijing Hospital data were used to verify the results (Figure 8A-B). We found that LCK expression was positively correlated with the expression of PD-1, PD-L1 and CTLA4 (Figure 9A-C). However, the high expression of PD-1/PD-L1 in tumours inhibits the sensitivity of HCC patients to ICIs^[³⁶^]. Therefore, to further prove the influence of LCK expression on the response to immunotherapy, we used the MCP-counter algorithm to generate an immune score heatmap based on the differences in LCK expression in the TCGA data (Figure 9D); the results showed that the immune score of the group with high LCK expression was significantly higher than that of the group with low LCK expression. Second, by plotting the correlation between LCK and the P53 signalling pathway, we found that LCK expression was positively correlated with P53 expression (Figure 9E), further proving that LCK may increase the sensitivity of HCC patients to ICIs.

Enrichment Analysis

To elucidate the mechanisms by which LCK regulates TLS formation and the response to immunotherapy in HCC patients, we performed KEGG and GO enrichment analyses. As shown in the figure, upregulation of LCK expression significantly affected cytokine–cytokine receptor interactions, the chemokine signalling pathway, T-cell activation and other related molecular pathways (Figure 10A-B). Downregulation of LCK expression mainly affected cellular metabolism and other related molecular pathways (Figure 10C-D). Therefore, LCK may play an important role in the formation of TLSs.

IC50 Scores

Currently, targeted therapy for HCC is at a bottleneck stage, mainly due to the immune escape of tumour cells and the immune tolerance of HCC patients to targeted drugs. Our study showed that the IC50 values of sorafenib and imatinib in the high LCK expression group were significantly lower than those in the low LCK expression group (Figure 11). Therefore, TLSs and LCK expression can be used as potential targets for precision treatment of individual HCC patients.

In recent years, precision therapy for HCC, such as neoadjuvant therapy, has made significant breakthroughs in clinical practice, not only improving the resection rate of HCC but also significantly extending the median survival of HCC patients^[37]. However, the ORRs of HCC patients to targeted drugs and ICIs have remained low, seriously limiting the clinical application of neoadjuvant therapy^[38]. Studies have shown that the high expression of immune checkpoints on TILs inhibits the antitumour responses of T and B cells, so TILs may be the ultimate target of immunotherapy^[39]. TLSs are recently discovered immune structures that are formed by lymphocyte aggregation and that can enhance the ORRs of tumour patients to targeted drugs and ICIs^[24]. However, the formation of TLS is dependent on the recruitment of T and B cells by chemokines, so the regulation of chemokine production is the key to the antitumour function of TLSs^[16]. Studies have shown that CCL19 and CCL21 mediate T-cell and DC migration and that CXCL13 activates B cells, which are the critical conditions for TLS formation^[30]. In addition, follicular helper T (Tfh) cells are necessary for B cells to exert humoral immunity; one of the reasons that B cells accumulate in the TME is the secretion of CXCL13 by Tfh cells^[40]. B cells can also play the role of antigen presenting cells, secreting anti-inflammatory cytokines to further enhance the antitumour ability of T cells, DCs and NK cells^[41]. B cells have been shown to function as lymphoid tissue inducer cells, secreting IL-22 to regulate TLS formation^[42]. TLSs, in turn, promote tumour antigen presentation, T-cell activation and B-cell antibody secretion, thus triggering the development of adaptive antitumour immune responses^[43]. This illustrates the capacity of TLSs to exert effects beyond those on B cells and participate in the activation of the adaptive immune system in a local immune response^[30]. Our results demonstrate that the expression of LCK is positively correlated with that of chemokines, that LCK is a key signalling molecule in T-cell maturation, and that chemokines can further enhance T-cell metastasis and antitumor activity by stimulating LCK expression^[31–33]. The enrichment analysis showed that LCK expression could positively regulate or activate cytokine–cytokine receptor interactions, the chemokine signalling pathway and the T-cell activation signalling pathway. CXC chemokines are mainly involved in cytokine–cytokine receptor interactions^[44]. In addition, previous studies have shown that LCK can increase the expression and migration of chemokines (such as CCL19, CCL21, CXCL9, CXCL10, CXCL11 and CXCL13)^{[45, 46]}. Therefore, due to this positive feedback regulation, LCK expression may be a factor that participates in the formation of TLSs.

The TLS-related molecule CXCL13 is associated with good prognosis in HCC patients^[47], and the expression of CCL19 and CCL21 in tumours can promote the antitumour effect of TILs^[48]. However, chemokines released by HCC (CXCL-2, CXCL8 and CCL25) in turn increase the proportion of neutrophils in the TME, forming an immunosuppressive microenvironment and leading to tumour progression^{[49, 50]}. According to our results, LCK expression is positively correlated with the number of neutrophils, and increased expression of LCK promotes the aggregation of neutrophils in the TME. This contradictory phenomenon does not negate the protective effects of LCK expression in HCC because the complexity and functional diversity of TME components do not depend on the function of a single component. Therefore, to verify the function of LCK in the response to immunotherapy, we evaluated the immune score of HCC based on the differences in LCK expression. The results showed that high LCK expression could positively regulate the immune function of HCC patients. The lymphocyte-based immune score is an indicator of good prognosis in HCC patients; the higher the immune score is, the higher the ORR of HCC patients to ICIs^{[51, 52]}.

PD-1 and PD-L1 are expressed not only by T cells and tumour cells but also by macrophages, DCs, B cells and other immune cells. Therefore, ICIs can indirectly activate TLSs by blocking the PD-1/PD-L1 pathway and thereby activate the expression of immune cells, thus enhancing the antitumour effect^[53]. For example, nivolumab and pembrolizumab treat advanced liver cancer by reducing the expression of PD-1 and thereby decreasing T-cell depletion^[36]. In addition, high expression of PD-L1 can increase the level of AFP in the blood of HCC patients, thus promoting tumour progression^[54]. However, our study showed that the expression of LCK was positively correlated with the expression of PD-1, PD-L1 and CTLA4. However, to verify that LCK may promote the sensitivity of HCC patients to ICIs, we calculated the immune scores of HCC patients in different groups based on difference in LCK expression. The results showed that HCC patients with high expression of LCK had higher immune scores. The higher the immune score is, the higher the objective response rate of HCC patients to ICIs^{[51, 52]}. Activation and maturation of T cells can increase the sensitivity of HCC patients to ICIs^{[55, 56]}. When LCK activates T cells, the secretion of IL-2 increases, which in turn activates CD8 + T cells within the tumour to increase the ability of ICIs to inhibit tumours and reduce drug toxicity^{[57, 58]}. Second, by studying the correlation between LCK and the P53 signalling pathway, we found that LCK expression was positively correlated with P53 expression, and previous studies found that P53 could increase the sensitivity of HCC patients to ICIs^{[59, 60]}. In conclusion, LCK may increase the sensitivity of HCC patients to ICIs. Sorafenib combined with ICIs was significantly better than sorafenib monotherapy in treating patients with advanced HCC (e.g., the combination improved median survival and progression-free survival)^[61]. Therefore, we studied the differences in the IC50 distributions of targeted drugs based on differences in LCK expression. The results showed that the IC50 values of sorafenib and imatinib in HCC patients with high LCK expression were significantly lower than those in HCC patients with low LCK expression, indicating that HCC patients with high LCK expression were more sensitive to sorafenib and imatinib. Sorafenib and imatinib alone can prolong the survival of HCC patients, and their combination has a synergistic effect on inhibiting the progression of HCC^[62]. Therefore, the TLS-related molecule LCK is a potential and promising therapeutic target that can prolong the median survival time of HCC patients.

Our study demonstrates that TLSs are an independent protective factor for RFS in HCC patients and elucidates the molecular mechanisms by which TLSs regulate the HCC response to immunotherapy. In addition, the upregulation of LCK expression can further promote the formation of TLSs and improve the sensitivity of HCC patients to targeted drugs. Therefore, TLSs and LCK are potential therapeutic targets.

Conflicts of Interest

The authors have no conflicts of interest to declare.

Author Contributions

Jianhui Li, Zhuolin Cao, Kaishan Tao and Wenjie Song designed the study. Jianhui Li, Wenlong Wu and Ye Nie conducted the statistical analysis. Tianchen Zhang, Xinjun Lei, Zhenzhen Mao and Yanfang Wang performed the qRT–PCR, HE and IF/IHC experiments. Jianhui Li, Ye Nie and Zhuolin Cao drafted the manuscript. Wenlong Wu and Kaishan Tao made relevant edits to the manuscript. Zhuolin Cao, Kaishan Tao and Wenjie Song revised the manuscript.

Ethics Approval and Consent to Participate

This study was approved by the Institutional Ethics Committee of Xijing Hospital of the Fourth Military Medical University (approval number: KY20202115-C-1). Written informed consent was obtained from each participant.

Funding

This work was supported by the National Natural Science Foundation of China (81672716, 81900571).

Consent to Publish (Ethics)

All the authors agreed to be published.

Animal Research (Ethics)

No animal experiments were involved in this study.

Clinical Trials Registration

This study was approved by the Ethics Committee of Xijing Hospital (KY20202115-C-1) and was conducted in accordance with the criteria of the Declaration of Helsinki.

Data Availability Statements

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Sung H, Ferlay J, Siegel R, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries[J]. CA: a cancer journal for clinicians, 2021,71(3):209–249.
Chen W, Zheng R, Baade PD, et al. Cancer statistics in China, 2015[J]. CA Cancer J Clin. 2016;66(2):115–32.
Koulouris A, Tsagkaris C, Spyrou V, et al. Hepatocellular Carcinoma: An Overview of the Changing Landscape of Treatment Options[J]. J Hepatocell Carcinoma. 2021;8:387–401.
Xu J, Wan Z, Tang M, et al. N-methyladenosine-modified CircRNA-SORE sustains sorafenib resistance in hepatocellular carcinoma by regulating β-catenin signaling[J]. Mol Cancer. 2020;19(1):163.
Wang L, Wang F. Clinical immunology and immunotherapy for hepatocellular carcinoma: current progress and challenges[J]. Hep Intl. 2019;13(5):521–33.
Shigeta K, Datta M, Hato T, et al. Dual Programmed Death Receptor-1 and Vascular Endothelial Growth Factor Receptor-2 Blockade Promotes Vascular Normalization and Enhances Antitumor Immune Responses in Hepatocellular Carcinoma[J]. Hepatology (Baltimore MD). 2020;71(4):1247–61.
Llovet J, De Baere T, Kulik L, et al. Locoregional therapies in the era of molecular and immune treatments for hepatocellular carcinoma[J]. Nat reviews Gastroenterol Hepatol. 2021;18(5):293–313.
Hao X, Sun G, Zhang Y, et al. Targeting Immune Cells in the Tumor Microenvironment of HCC: New Opportunities and Challenges[J]. Front cell Dev biology. 2021;9:775462.
Wan P, Ryan A, Seymour L. Beyond cancer cells: Targeting the tumor microenvironment with gene therapy and armed oncolytic virus[J]. Mol therapy: J Am Soc Gene Therapy. 2021;29(5):1668–82.
Helmink B, Reddy S, Gao J, et al. B cells and tertiary lymphoid structures promote immunotherapy response[J]. Nature. 2020;577(7791):549–55.
Tang J, Ramis-Cabrer D, Curull V, et al. B Cells and Tertiary Lymphoid Structures Influence Survival in Lung Cancer Patients with Resectable Tumors[J]. Cancers, 2020,12(9).
Yamaguchi K, Ito M, Ohmura H, et al. Helper T cell-dominant tertiary lymphoid structures are associated with disease relapse of advanced colorectal cancer[J]. Oncoimmunology. 2020;9(1):1724763.
Calderaro J, Petitprez F, Becht E, et al. Intra-tumoral tertiary lymphoid structures are associated with a low risk of early recurrence of hepatocellular carcinoma[J]. J Hepatol. 2019;70(1):58–65.
Tavares R, Turer E, Liu C, et al. The ubiquitin modifying enzyme A20 restricts B cell survival and prevents autoimmunity[J]. Immunity. 2010;33(2):181–91.
Li H, Wang J, Liu H, et al. Existence of intratumoral tertiary lymphoid structures is associated with immune cells infiltration and predicts better prognosis in early-stage hepatocellular carcinoma[J]. Aging. 2020;12(4):3451–72.
He W, Zhang D, Liu H, et al. The High Level of Tertiary Lymphoid Structure Is Correlated With Superior Survival in Patients With Advanced Gastric Cancer[J]. Front Oncol. 2020;10:980.
Sakimura C, Tanaka H, Okuno T, et al. B cells in tertiary lymphoid structures are associated with favorable prognosis in gastric cancer[J]. J Surg Res. 2017;215:74–82.
Ahmed A, Halama N. Tertiary Lymphoid Structures in Colorectal Cancer Liver Metastases: Association With Immunological and Clinical Parameters and Chemotherapy Response[J]. Anticancer Res. 2020;40(11):6367–73.
Maoz A, Dennis M, Greenson J. The Crohn's-Like Lymphoid Reaction to Colorectal Cancer-Tertiary Lymphoid Structures With Immunologic and Potentially Therapeutic Relevance in Colorectal Cancer[J]. Front Immunol. 2019;10:1884.
Gunderson J, Rajamanickam A, Bui V. C, et al. Germinal center reactions in tertiary lymphoid structures associate with neoantigen burden, humoral immunity and long-term survivorship in pancreatic cancer[J]. Oncoimmunology. 2021;10(1):1900635.
Zhou L, Xu B, Liu Y, et al. Tertiary lymphoid structure signatures are associated with survival and immunotherapy response in muscle-invasive bladder cancer[J]. Oncoimmunology. 2021;10(1):1915574.
Noël G, Langouo Fontsa M, Garaud S, et al. Functional Th1-oriented T follicular helper cells that infiltrate human breast cancer promote effective adaptive immunity[J]. The Journal of clinical investigation; 2021.
Ruffin A, Cillo A, Tabib T, et al. B cell signatures and tertiary lymphoid structures contribute to outcome in head and neck squamous cell carcinoma[J]. Nat Commun. 2021;12(1):3349.
Cabrita R, Lauss M, Sanna A, et al. Tertiary lymphoid structures improve immunotherapy and survival in melanoma[J]. Nature. 2020;577(7791):561–5.
Sautès-Fridman C, Petitprez F, Calderaro J, et al. Tertiary lymphoid structures in the era of cancer immunotherapy[J]. Nat Rev Cancer. 2019;19(6):307–25.
Finkin S, Yuan D, Stein I, et al. Ectopic lymphoid structures function as microniches for tumor progenitor cells in hepatocellular carcinoma[J]. Nat Immunol. 2015;16(12):1235–44.
Calderaro J, Petitprez F, Becht E, et al. Intra-tumoral tertiary lymphoid structures are associated with a low risk of early recurrence of hepatocellular carcinoma[J]. J Hepatol. 2019;70(1):58–65.
Munoz-Erazo L, Rhodes J, Marion V, et al. Tertiary lymphoid structures in cancer - considerations for patient prognosis[J]. Cell Mol Immunol. 2020;17(6):570–5.
Tokunaga R, Nakagawa S, Sakamoto Y, et al. 12-Chemokine signature, a predictor of tumor recurrence in colorectal cancer[J]. Int J Cancer. 2020;147(2):532–41.
Pimenta E, Barnes B. Role of Tertiary Lymphoid Structures (TLS) in Anti-Tumor Immunity: Potential Tumor-Induced Cytokines/Chemokines that Regulate TLS Formation in Epithelial-Derived Cancers[J]. Cancers. 2014;6(2):969–97.
D'Andrilli A, Natoli G, Scarpino S, et al. Stage I non-small cell lung cancer: the presence of the lymphocyte-specific protein tyrosin kinase in the tumour infiltrate is associated with a better long-term prognosis[J]. Interact Cardiovasc Thorac Surg. 2012;15(1):148–51.
Wu J, Li G, Li L, et al. Asparagine enhances LCK signalling to potentiate CD8 T-cell activation and anti-tumour responses[J]. Nat Cell Biol. 2021;23(1):75–86.
Park D, Park I, Lee D, et al. The adaptor protein Lad associates with the G protein beta subunit and mediates chemokine-dependent T-cell migration[J]. Blood. 2007;109(12):5122–8.
Liew K, Yu G, Wei Pua L, et al. Parallel genome-wide RNAi screens identify lymphocyte-specific protein tyrosine kinase (LCK) as a targetable vulnerability of cell proliferation and chemoresistance in nasopharyngeal carcinoma[J]. Cancer Lett. 2021;504:81–90.
Li Z, Lei Z, Xia Y, et al. Association of Preoperative Antiviral Treatment With Incidences of Microvascular Invasion and Early Tumor Recurrence in Hepatitis B Virus-Related Hepatocellular Carcinoma[J]. JAMA Surg. 2018;153(10):e182721.
Peña-Asensio J, Calvo H, Torralba M, et al. Anti-PD-1/PD-L1 Based Combination Immunotherapy to Boost Antigen-Specific CD8 T Cell Response in Hepatocellular Carcinoma[J]. Cancers, 2021,13(8).
Zhang T, Zhang L, Xu Y, et al. Neoadjuvant therapy and immunotherapy strategies for hepatocellular carcinoma[J]. Am J cancer Res. 2020;10(6):1658–67.
Yang Y, Wang C, Sun H, et al. Apatinib prevents natural killer cell dysfunction to enhance the efficacy of anti-PD-1 immunotherapy in hepatocellular carcinoma[J]. Cancer Gene Ther. 2021;28:89–97.
Wong P, Wei W, Smithy J, et al. Multiplex Quantitative Analysis of Tumor-Infiltrating Lymphocytes and Immunotherapy Outcome in Metastatic Melanoma[J]. Clin cancer research: official J Am Association Cancer Res. 2019;25(8):2442–9.
Wang S, Liu W, Ly D, et al. Tumor-infiltrating B cells: their role and application in anti-tumor immunity in lung cancer[J]. Cell Mol Immunol. 2019;16(1):6–18.
Stoycheva D, Simsek H, Weber W, et al. External cues to drive B cell function towards immunotherapy[J]. Acta biomaterialia; 2021.
Salem D, Chelvanambi M, Storkus W, et al. Cutaneous Melanoma: Mutational Status and Potential Links to Tertiary Lymphoid Structure Formation[J]. Front Immunol. 2021;12:629519.
Dieu-Nosjean M. Tumor-Associated Tertiary Lymphoid Structures: A Cancer Biomarker and a Target for Next-generation Immunotherapy[J]. Adv Exp Med Biol. 2021;1329:51–68.
Jin Y, Lin Q, Fei H, et al. Bioinformatics Analysis of Potential Therapeutic Targets and Prognostic Biomarkers amid CXC Chemokines in Ovarian Carcinoma Microenvironment[J]. J Oncol. 2021;2021:8859554.
Schaeuble K, Hauser M, Singer E, et al. Cross-talk between TCR and CCR7 signaling sets a temporal threshold for enhanced T lymphocyte migration[J]. J Immunol (Baltimore Md: 1950). 2011;187(11):5645–52.
Sun X, Chen Q, Zhang L, et al. Exploration of prognostic biomarkers and therapeutic targets in the microenvironment of bladder cancer based on CXC chemokines[J]. Math Biosci engineering: MBE. 2021;18(5):6262–87.
Duan Z, Gao J, Zhang L, et al. Phenotype and function of CXCR5 + CD45RA-CD4 + T cells were altered in HBV-related hepatocellular carcinoma and elevated serum CXCL13 predicted better prognosis[J]. Oncotarget. 2015;6(42):44239–53.
Tokunaga R, Naseem M, Lo J, et al. B cell and B cell-related pathways for novel cancer treatments[J]. Cancer Treat Rev. 2019;73:10–9.
Zhu Q, Pan Q, Zhong A, et al. Annexin A3 upregulates the infiltrated neutrophil-lymphocyte ratio to remodel the immune microenvironment in hepatocellular carcinoma[J]. Int Immunopharmacol. 2020;89:107139.
Xu X, Ye L, Zhang Q, et al. Group-2 Innate Lymphoid Cells Promote Hepatocellular Carcinoma Progression via CXCL2-Neutrophil Induced Immunosuppression[J]. Hepatology (Baltimore, Md), 2021.
Liu S, Yu G, Liu L, et al. Identification of Prognostic Stromal-Immune Score-Based Genes in Hepatocellular Carcinoma Microenvironment[J]. Front Genet. 2021;12:625236.
Wang J, Han K, Zhang C, et al. Identification and validation of ferroptosis-associated gene-based on immune score as prognosis markers for hepatocellular carcinoma patients[J]. J Gastrointest Oncol. 2021;12(5):2345–60.
Lauss M, Donia M, Svane I, et al. B cells and tertiary lymphoid structures: friends or foes in cancer immunotherapy?[J]. Clinical cancer research: an official journal of the American Association for Cancer Research, 2021.
Liu G, Li X, Zhang Y. Prognostic role of PD-L1 for HCC patients after potentially curative resection: a meta-analysis[J]. Cancer Cell Int. 2019;19:22.
Zuazo M, Arasanz H, Fernández-Hinojal G, et al. Functional systemic CD4 immunity is required for clinical responses to PD-L1/PD-1 blockade therapy[J]. EMBO Mol Med. 2019;11(7):e10293.
Sugiura D, Shimizu K, Maruhashi T, et al. T-cell-intrinsic and -extrinsic regulation of PD-1 function[J]. Int Immunol. 2021;33(12):693–8.
Feng S, Cheng X, Zhang L, et al. Myeloid-derived suppressor cells inhibit T cell activation through nitrating LCK in mouse cancers[J]. Proc Natl Acad Sci USA. 2018;115(40):10094–9.
Ren Z, Zhang A, Sun Z, et al. Selective delivery of low-affinity IL-2 to PD-1 + T cells rejuvenates antitumor immunity with reduced toxicity[J]. The Journal of clinical investigation, 2022,132(3).
Fang D, Tang Q, Kong Y, et al. MDM2 inhibitor APG-115 synergizes with PD-1 blockade through enhancing antitumor immunity in the tumor microenvironment[J]. J Immunother Cancer. 2019;7(1):327.
Xiao Y, Chen J, Zhou H, et al. Combining p53 mRNA nanotherapy with immune checkpoint blockade reprograms the immune microenvironment for effective cancer therapy[J]. Nat Commun. 2022;13(1):758.
Llovet J, Castet F, Heikenwalder M, et al. Immunotherapies for hepatocellular carcinoma[J]. Nature reviews Clinical oncology; 2021.
Xiao M, Qian H, Huang C, et al. Imatinib inhibits the malignancy of hepatocellular carcinoma by suppressing autophagy[J]. Eur J Pharmacol. 2021;906:174217.

The mechanism by which tertiary lymphoid structures in tumours affect prognosis and immunotherapy in patients with hepatocellular carcinoma

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Material And Methods

Results

Discussion

Conclusion

Declarations

References

Status:

Version 1