2.1 Study subjects
This study enrolled patients with IBD who admitted at the gastroenterology department of People’s Hospital of Ningxia Hui Autonomous Region from December 2019 to December 2021. According to diagnostic criteria issued by American College of Gastroenterology (ACG) in 2010 [23] , our study included 34 UC patients (22 cases in active period and 12 cases in remission period) and 15 CD patients (9 cases in active period and 6 cases in remission period). Before enrollment, all patients did not receive following treatments like corticosteroids, immunosuppressive agents or biological agents, and were without other autoimmune diseases, infectious diseases and neoplastic diseases. The severity of diseases was assessed according to international standard criteria such as Crohn’s disease activity index (CDAI) for the diagnosis of patients with CD and Mayo scores for patients with UC. Peripheral venous blood and serum were taken from 30 healthy examinees as healthy control (HC)group. All the subjects presented no significant differences in gender and age with comparability (all P > 0.05). The baseline information of all the patients was shown in Table 1. Before experiments, all the subjects and relatives of the study were informed and signed the informed consents. This experiment got the permission from the Ethics Committee of People’s Hospital of Ningxia Hui Autonomous Region, and followed the Declaration of Helsinki .
Table 1
Clinical characteristics of Healthy controls and IBD patients.
Abbreviations: A/R: Active/Remission, CD, Crohn’s disease, CDAI, Crohn’s disease activity index, HC, healthy control, UC, ulcerative colitis.
2.2 Isolation and transfection of Peripheral Blood CD4+ T cells
Peripheral blood mononuclear cells(PBMC)and serum were isolated from EDTA anticoagulated blood samples obtained from HCs, CD patients, and UC patients by density centrifugation using Ficoll-Paque™ Plus (GE Healthcare Bio-Science, USA). The PBMC were obtained using the human lymphocyte cell separation medium kit(Solarbio Life Sciences, P.R.China)according to the manufacturer’s instructions. Subsequently, peripheral blood CD4+T cells were isolated using magnetic-activated cell separation (MACS) and a human naïve CD4+T Cell Isolation Kit(Miltenyi Biotec, Germany). The purity of peripheral blood CD4 +T cells was >95% assessed by flow cytometry. CD4+T cells were incubated in human T cell culture medium (Thermo Fisher) supplemented with 15% fetal bovine serum (FBS) and 100g/ml penicillin G and streptomycin. CD4+T cells from heathy controls group were classified into blank group, negative control(NC) group, hsa-miR-374b-5p mimics group at 50nmol/ml (Qiagen,219600) and hsa-miR-374b-5p inhibitors group at 200nmol/ml (Qiagen,219300)using Hiperfect Transfection Reagent (Qiagen) according to the manufacturer’s protocols. After 4 h, the transfected cells were treated with human anti-CD3 (1μg/ml) and human anti-CD28 (1μg/ml) (eBioscience) for 48h at 37°C.
2.3 qRT-PCR
Total RNA was extracted from the serum of IBD patients and healthy controls using Trizol reagent (Invitrogen) according to the manufacturer’s procedures. For miRNA-specific reverse transcription, the reaction was performed using the Mir-XTM miRNA First-Strand Synthesis Kit (Takara) and reverse transcription primers from Mir-XTM miRNA First-Strand Synthesis Kit (Takara) on the ABI 7500 fast real-time PCR system (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s instructions. The hsa-miR-374b-5p and hsa-miR-106a-5p PCR primers were purchased from Qiagen. U6 was utilized as an internal control. U6, forward:5’-CTCGCTTCGGCAGCACA--3’,reverse:5’-AACGCTTCACGAATTTGCGT-3’. The relative miRNA levels were calculated using the 2 –ΔΔCt method.
Total RNA was extracted from CD4+T cells of transfected cells using Trizol reagent (Invitrogen) according to the manufacturer’s instructions and the levels of gene expression were measured by real-time qRT-PCR. Reverse Transcription-Quantitative Polymerase Chain Reaction was performed using the PrimeScriptTM RT Master Mix(Takara) and TB GreenTM Advantage qPCR Premix (Takara). The human PCR primers were designed by the use of the Primer-BLAST tool on the NCBI website. IFN-γ: (forward)GCCACGGCACAGTCATTGA,(reverse) TGCTGATGGCCTGATTGTCTT,IL-17A:(forward)TTTAACTCCCTTGGCGCAAAA,(reverse)CTTTCCCTCCGCATTGACAC,IL-10:(forward)AGCCTTATCGGAAATGATCCAGT,(reverse)GGCCTTGTAGACACCTTGGT,STAT3:(forward)TGTGTGACACCATTCATTGATGC,(reverse)TGCCCAGATTGCCCAAAGAT,JAK1:(forward)GCCAGTGCCCTGAGTTACTT,(reverse)GTCTGGATCTTGCCTGGTCA. All mRNA expressions were normalized to GAPDH gene expression. GAPDH, forward: 5'-CCATGTTTGTGATGGGTGTG-3', reverse:5'-CCTTCTTGATGTCATCATAC-3, The qPCR results were calculated using the 2 –ΔΔCt method.
2.4 Hsa-miR-374b-5p and hsa-miR-106a-5p target gene prediction and dual-luciferase reporter assay
Potential hsa-miR-374b-5p target was sorted by utilizing miRNA prediction software TargetScan(targetscan.org), MIRDB(www.mirdb.org) and found IL-10 was the target gene of hsa-miR-374b-5p which was associated with IBD and inflammation. For the luciferase reporter assay, the pmirGLO firefly luciferase reporter plasmids with the wild type(WT) or MUT 3’ (untranslated region)UTR sequences of IL-10 were transiently transfected into HEK293T cells along with hsa-miR-374b-5p mimics or negative controls and a Renilla luciferase reporter for normalization.
Another potential target gene STAT3 of hsa-miR-106a-5p was found which was also associated with IBD development. For the luciferase reporter assay, the psiCHECK-2 firefly luciferase reporter plasmids with the wild type(WT) or MUT 3’ (untranslated region)UTR sequences of h-STAT3 were transiently transfected into HEK293T cells along with hsa-miR-106a -5p mimics or negative controls and a Renilla luciferase reporter for normalization.
After 48 hours, the luciferase activities were measured by DualLuciferase® Reporter Assay System. Based on the cells transfected by pmirGLO control vector or psiCHECK-2 control vector, the mean of the results was set as 100%. Data are showed by mean and standarddeviation (SD) of separate transfection.
2.5 T cell differentiation
Naïve CD4+T cells (5×105 cells/well) were cultured at 37°C (5%CO2) in human T cell culture medium (Thermo Fisher) supplemented in each well of 96-well plates and were then transfected with 50nmol/ml hsa-miR-374b-5p mimics (Qiagen) and 200nmol/ml hsa-miR-374b-5p inhibitors (Qiagen) using Hiperfect Transfection Reagent (Qiagen) according to the manufacturer’s protocols. MiScript negative control siRNA sequence (Qiagen) was used as a control. After 4h, the transfected cells were differentiated into Th1 ,Th2 , Th17 of CD4+T cells using three different cytokine regimens in 48-well plates. Then we followed the methods of Farshid Noorbakhsh et al.2017 [24] . For Th1 cells, transfected cells were cultured in complete RPMI, plate-bound CD3 antibody (1μg/ml), and soluble CD28 antibody (1μg/ml), IL-2 (20 ng/ml), IL-12 (50 ng/ml), and anti-IL-4 antibody (10ng/ml) (BD Biosciences) for 96 h. For Th2, the cells were treated with 1μg/ml plate-bound CD3 antibody, 1μg/ml anti-CD28, 20ng/ml IL-2, 10ng/ml IL-4 (BD Biosciences) and 10ng/ml anti-IFN-γ for 96h. To differentiate the cells into Th17 cells, transfected cells were cultured in complete RPMI, plate-bound CD3 antibody(1μg/ml), and soluble CD28 antibody (0.2 μg/ml), TGF-β (5ng/ml), IL-6 (100ng/ml), anti-IFN-γ (10ng/ml), anti-IL-4 (10ng/ml), and IL-23 (50 ng/ml) (BD Biosciences) for 96 h.
2.6 Flow cytometry
For intracellular staining, cells were stimulated with Cell Stimulation Cocktail plus Protein Transport Inhibitors(Invitrogen)for 6h before staining. To detect the intracellular expression of IFN-γ, IL-17A, IL-10 in transfected human CD4+ T cells, cells (0.5×106/wells) were subjected to intracellular cytokine staining using a Cell Fixation/Permeabilization Kit (Invitrogen) following the manufacturer’s instructions. Cells were stained with human anti-CD4 and anti-CD3 antibodies and then fixed with Invitrogen’s Fixation Buffer for 30 min at 4°C in darkness. Cells were permeabilized with Invitrogen’s Permeabilization Buffer (1×) and then stained with flurochrome-conjugated anti-IFN-γ, anti-IL-17A, and anti-IL-10(BD Biosciences). Stained cells were assayed with a BD FACSCalibur flow cytometer (BD Biosciences), and results were analyzed with FlowJoⅩsoftware (Tree star, Inc.).
2.7 Western blot
The PBMC were obtained using the human lymphocyte cell separation medium kit (Solarbio Life Sciences, P.R. China) according to the manufacturer’s instructions. Naïve CD4+T cells of health controls PBMC were isolated using human naïve CD4+T Cell Isolation Kit(Miltenyi Biotec, Germany ). The purity of Naïve human CD4+ T cells was >95% assessed by flow cytometry. Naïve CD4+ T cells were incubated in human T cell culture medium (Thermo Fisher) supplemented with 15% fetal bovine serum (FBS) and 100g/ml penicillin G and streptomycin. Naïve CD4+T cells from healthy control group were classified into blank group, negative control (NC) group, hsa-miR-374b-5p mimics group at 50nmol/ml (Qiagen,219600)and hsa-miR-374b-5p inhibitors group at 200nmol/ml (Qiagen,219300)using Hiperfect Transfection Reagent (Qiagen) according to the manufacturer’s protocols. After 4 h, the transfected cells were treated with human anti-CD3 (1μg/ml) and anti-CD28 (1μg/ml) (eBioscience) for 48h at 37°C. The proteins concentrations were determined using bicinchoninic acid protein assay kit (Thermo Fisher). The proteins were separated on 8% sodium dodecyl sulfate‐polyacrylamide gels. The proteins were subjected to electrophoresis and transferred onto polyvinylidene difluoridemembranes (0.45µm, Amersham Biosciences). The membranes were blocked with 5% nonfat dry milk at room temperature after transfer. Subsequently, the membranes were incubated overnight at 4°C with rabbit‐monoclonal anti-IL-10 antibody, anti‐STAT3 antibody (Abcam), anti‐p-STAT3 (ser727) antibody (Abcam), anti-JAK1 antibody and anti‐GAPDH (Abcam) antibody. The horseradish peroxidase (Santa Cruz)‐conjugated secondary antibody (goat antirabbit antibody, Abcam) was added after washing with Tris buffered saline. The expression of IL-10 , STAT3 ,p‐STAT3 ,JAK1 were quantified relative toβ-actin expression with Image software (National Institutes of Health).
2.8 Statistical analysis
All statistical analyses were performed using Prism 7.0 (GraphPad Software). Data were obtained from at least three independent experiments and represented as mean ± standard error. Statistical analysis was conducted using the Student’s t-test or the Mann-Whitney U tests. Results were considered significant at P < 0.05.