Chemicals:
PEG 2000-Liposomal doxorubicin, PEG 2000-liposomal dexamethasone, PEG 2000-liposomal curcumin, doxorubicin, dexamethasone and curcumin were purchased from Sigma-Aldrich Co (St. Louis, MO, USA). RT-PCR kits of PI3K. AKT and GSK3 were provided from Qiagen USA. ELISA kits for prostate specific antigen (PSA) were obtained from R & D systems (MN, USA) and long non coding RNA (MALAT1) kits were provided from Qiagen USA. All other chemicals were of the highest analytical grade.
Preparation of liposomal nanoparticles:
Liposomes for therapeutic purposes are manufactured using lipids, cholesterol and drug in a specific ratio. Functional groups are generally covalently bound to PEG which is normally 5% mol/mol of the total lipid [20]. To ensure a homogenous mixture of the liposome formulation, tertiary butanol or cyclohexanes: methanol was used as solvents. After freezing completely, the frozen lipid cake was placed on a vacuum pump and lyophilized until dry. Dry lipid films or cakes were then be hydrated to obtain onion-like multilamellar vesicles (MLV). Small unilamelar vesicles (30–100 nm) was obtained by sonication or extrusion of MLV [21]. When injected in tumor-bearing mice, liposomes loaded nanoparticles was distributed in the prostate.
Animals and treatments
Sixty four male Western Albino rats weighing 170-190 g (6-8 weeks) old, from the animal house of National Research Center will be used in this study. Animals will be kept at standardized conditions (22 ± 5°C, 55 ± 5% humidity, and 12 h light/dark cycle). They will be allowed free access to water and pelleted standard chow diet. All procedures relating to animal care and treatments strictly will adhere to the ethical procedures (12020206) and policies approved by Animal Care and Use Committee of National Research Center, and US National Institute of Health.
Experimental Design
1 week post acclimatization, animals will be randomly divided into eight groups (8 rats each) and was divided according to the following schedule:
Group1: Animals received saline and served as control group.
Group 2: prostate cancer induced experimentally in rats via a diet containing 0.75 ppm of ethinyl estradiol for 3 weeks and a basal diet for 2 weeks alternately 10 times, and 2 days after each change to basal diet, a single SC. injection of 50 mg/kg body weight of 3,2'- dimethyl-4-aminobiphenyl estradiol (DAE) respectively as prostate cancer model [8]. Rats were kept for 8 months till the incidence of prostate cancer then were treated as follows:
Groups 3: Intoxicated group was treated with PEG-liposomal carried doxorubicin in a dose of (3 mg/kg BW) IP for 1 month post prostate cancer induction via DAE [22].
Groups 4: Intoxicated group was treated via doxorubicin in a dose of (5 mg/kg BW) IP for 1 month post prostate cancer induction [22].
Groups 5: Intoxicated group was treated viaPEG-liposomal carried dexamethasone in a dose of (3 mg/kg BW) IP for 1 month [22].
Groups 6: Intoxicated group was treated via dexamethasone in a dose of (5 mg/kg BW) IP for 1 month post prostate cancer induction [22].
Groups 7: Intoxicated group was treated via PEG-liposomal carried curcumin in a dose of (3 mg/kg BW) IP for 1 month [22].
Groups 8: Intoxicated group was treated via curcumin in a dose of (5 mg/kg BW) IP for 1 month [22].
1. Blood sampling and tissue preparation
At the end of the experimental period, rats were weighed, slightly anesthetized via light ether and blood samples were collected from the sublingual vein. Sera was separated by centrifugation at 4000 rpm for 10 min and was kept at − 80 °C for subsequent estimation of biochemical and molecular analysis.
Animals were then sacrificed via cervical dislocation and prostate tissue was carefully separated, and then divided into portions. The first portion was homogenized in 4 volumes of phosphate buffer, pH 7.4, using Teflon homogenizer (Glass-Col homogenizer, Terre Haute, USA). An aliquot of this homogenate (20 % w/v) was centrifuged at 4000 rpm at 4 OC for 15 min and the supernatant was used for ELISA determination. The second portion of the prostate was used for RT-PCR, long non coding RNA estimation. The remaining portion was kept in 10% formaldehyde, and then embedded in paraffin for subsequent histopathological examination.
2. Measured biochemical parameters
Prostate cancer tumor markers:
The activity of prostate specific antigen (PSA) was assayed using ELISA kits (R &D systems MN, USA). The assays estimated the quantitative sandwich enzyme immunoassay technique. Specific antibody was pre-coated onto the microplate. The standards and samples were pipetted into the wells and PSA was bound by the immobilized antibody and the absorbance was read at 450 nm [23].
mRNA gene expression of prostate AKT, PI3K and GSK-3:
Target gene expression analysis will be detected using real-time PCR according to specific forward and reverse primer for AKT, PI3K and GSK-3. Firstly, total RNA was be extracted from prostate tissue, samples using SV total RNA isolation system (Promega, Madison, WI), then extracted RNA was reverse transcribed into cDNA and amplified by PCR using RT-PCR kit (Stratagene, USA). Reactions was performed in a 50 µL final volume (25 µL SYBR Green Mix (2x), 0.5 µL cDNA, 2 µL primer pair mix (5 pmol/µLeach primer), 22.5 µL H2O). PCR reaction will be as follows: 50oC for 2 min, 95oC for 10 min and 95oC for 45 to 60 oC for 30 s and 72oC for 30 s then 72oC for 10 min [23].
Long non coding gene analysis for MALAT1
Large number of long noncoding RNAs are functional and, through regulatory mechanisms, are involved in carcinogenesis processes. Several long noncoding RNAs have been reported to be deregulated in prostate carcinoma, including MALAT and PCAT-1, and the prostate cancer gene 3 (PCA3).The PCA3 gene, initially called Differential Display Code 3 [25] described a strong over-expression of PCA3 gene in prostatic tumors compared with normal prostate tissue. PCA3 gene is inserted in the intron of a second gene, MALAT which is implicated in the control of oncogenic transformation, and it has been proposed that PCA3 regulates MALAT levels through the formation of a double-stranded RNA. The mRNA PCA3 was measured using quantitative real-time polymerase chain reaction (qRT-PCR) in a urine sample obtained after a prostate massage in order to obtain the maximum amount of prostatic cells. This measurement must be performed simultaneously with the mRNA of PSA gene, which has a similar expression in cancerous and benign cells. Thus, a PCA3 score based on the ratio of PCA3 mRNA to PSA mRNA can be determined. The Progensa PCA3 test, currently commercialized by Hologic, is a semiautomated assay that includes isolation, amplification, hybridization, and quantification of PCA3 and PSA mRNAs using the DTS systems.
MALAT1 was over-expressed in human cancers, including prostate, breast, pancreas, colon, and liver cancers. In prostate cancer, MALAT1 over-expression was associated with indicators of poor prognosis such as high Gleason score, higher tumor‐node‐metastasis stage and serum PSA >20 ng/mL and its expression was significantly higher in CRPC than in hormone‐sensitive prostate cancer. In a study comparing the expression of MALAT1 in urinary samples of biopsy‐positive and biopsy‐negative prostate cancer patients, this lncRNA was significantly higher in biopsy‐positive samples, suggesting that urinary MALAT1 may be a promising diagnostic biomarker [26].
CRISPR/Cas9 guide RNA design and plasmid construction
Target sequences of miR-205, miR-221, miR-455-3p, miR-222, miR-224, miR-505, miR-23b, miR-30c, miR-1225-5p and miR-663a for CRISPR interference was designed. Taking miR-205 as an example (Gene ID406988: The gene sequence 5′-AAAGATCCTCAGACAATCCATGTGCTTCTCTTGTCCTTCATTCCACCGGAGTATACCCAACCAGATTTCAGTGGAGTGAAGTTCAGGAGGCATGGAGC-3′ was retrieved and downloaded from GeneBank and the sgRNA was designed by Zhang lab using Target Finder (version 2014, and DNA 2.0 gRNA. A total of four optimal target sequences for each miRNA were selected and four scramble sequences were used as controls. Subsequently, two complementary oligonucleotides with Bbsl restriction sites for gRNAs was synthesized and cloned into CRISPR/Cas9 lentiCRISPR-v2 vector (cat. no. 52961; Addgene, Inc.) by HYYMed Company using T4 DNA ligase (cat. no. D2011B; Takara Biotechnology Co., Ltd.) [27].
Histopathological examination:
The prostate tissue was embedded in paraffin blocks, and then sliced into 5 μm in thickness. After hematoxylin–eosin (HE) staining, the slides were observed under optical microscope [28].
Statistical analysis:
Results were expressed as mean ± standard error mean (SEM) and was carried out by one-way analysis of variance (ANOVA) test at p < 0.05.