Quercetin activates autophagy suppresses apoptosis, inflammation and cartilage matrix degradation in LPS-induced chondrocytes through targeting AMPK/mTOR/ULK1 signaling pathway

doi:10.21203/rs.3.rs-1541634/v1

Download PDF

Research Article

Quercetin activates autophagy suppresses apoptosis, inflammation and cartilage matrix degradation in LPS-induced chondrocytes through targeting AMPK/mTOR/ULK1 signaling pathway

https://doi.org/10.21203/rs.3.rs-1541634/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Osteoarthritis (OA) is a chronic joint disease characterised by degeneration of articular cartilage, massive apoptosis of chondrocytes and changes in subchondral bone. Quercetin (QUE), a naturally occurring flavonoid, has shown potent anti-inflammatory effects; however, its effects and underlying mechanisms on OA have seldom been systematically illuminated. In this study, we explored the protective effects of QUE on repairing OA-induced chondrocytes injuries and its possible mechanisms.

Methods: Human articular chondrocytes were isolated and cultured, and then induced by lipopolysaccharide (LPS). Chondrocytes were assigned into Control group (normal complete culture medium), LPS induction group (Model group), QUE+LPS induction group (QUE group), 3-MA+LPS induction group (3-MA group), 3-MA+QUE+LPS induction group (3-MA+QUE group), compound C (Com C) +LPS induction group (Com C group) and Com C+QUE+LPS induction group (Com C +QUE group). The optimal intervention concentration of LPS and QUE were selected by the Cell Cycle Kit‑8 assay (CCK‑8), osteoarthritis and inflammatory factors relevant to osteoarthritis, interleukin‑1β (LI-1β) and tumor necrosis factor‑α(TNF-α), were tested by enzyme‑linked immunosorbent assay (ELISA). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed to detect mRNA expressions of autophagy-related genes (LC3 Ⅱ and P62). Western blotting and Immunofluorescence staining were utilized to detect expressions of cartilage matrix degradation, apoptosis and autophagy-related proteins and of relevant proteins in the AMPK/mTOR/ULK1 signaling pathway. Cell cycle and apoptosis were detected by flow cytometry. Transmission electron microscope (TEM) images were used to detect autophagosomes, and Lyso-Tracker Red was applied to measure lysosomal activity.

Results: In current study, we demonstrated that QUE can activate autophagy in LPS-induced chondrocytes. And, QUE can suppress apoptosis, inflammation and cartilage matrix degradation in LPS-induced chondrocytes by autophagy-based. Furthermore, these results demonstrated that QUE activates autophagy can suppress apoptosis, inflammation and cartilage matrix degradation in LPS-induced chondrocytes through targeting AMPK/mTOR/ULK1 signaling pathway.

Conclusions: QUE activates autophagy alleviated LPS-induced chondrocytes injuries through targeting AMPK/mTOR/ULK1 signaling pathway.

Osteoarthritis (OA)

Quercetin (QUE)

Chondrocytes

Autophagy

AMPK/mTOR/ULK1 signaling pathway

Osteoarthritis (OA) is a chronic degenerative joint disease characterised by degeneration of articular cartilage, massive apoptosis of chondrocytes and changes in subchondral bone, accompanied by osteophytes at the joint margins, with pain and loss of joint function as the main clinical manifestations [1–3]. With the increase in obesity and population ageing, the incidence of OA is increasing year by year [4, 5], and the current incidence of OA accounts for 4–13% of the world's population [1], of which the incidence of OA patients over 65 years of age is 50% [6], and the incidence of OA patients over 75 years of age has exceeded 80% [7], which seriously affects patients' quality of life and is also one of the main causes of disability [5]. The current pharmacological treatment of OA consists of oral painkillers, non‑steroidal anti‑inflammatory drugs and intra-articular injections of corticosteroids. However, these treatments only provide temporary relief and do not really stop the progression of OA and have side effects such as irritation of the gastrointestinal tract and an increased risk of cardiovascular disease. Therefore, exploring a better treatment for OA has been the focus of orthopaedic research. Although the pathogenesis of OA is not yet clear, it is generally believed that autophagy is essential for maintaining chondrocyte function, and a decrease in autophagic activity leads to the development of OA [8]. In the process of OA, the autophagic activity of chondrocytes decreases, resulting in a decrease in the ability to remove their own aging and damaged organelles and inflammatory factors, resulting in impaired chondrocyte function and apoptosis, which in turn leads to inflammatory reactions and disorders of the synthesis and breakdown of the extracellular matrix (ECM), resulting in cartilage degeneration [8–10].

Quercetin (3′,4′,5,7-pentahydroxyflavone [QUE]) is a rich natural flavonoid that is widely found in vegetables and fruits and has anti-inflammatory and anti-oxidative stress effects [3, 11, 12]. QUE has great value in the treatment of OA [13]. It has been shown that QUE has a therapeutic effect on OA by inhibiting the inflammatory response of chondrocytes and the degradation of cartilage extracellular matrix [3]. Wen et al. [14] showed that QUE inhibits IL-1β-induced inflammatory response and apoptosis in rat chondrocytes through inhibition of IRAK1/NLRP3 signaling pathway, thereby attenuating the progression of OA in rats. QUE can up-regulate SOD and TIMP1, down-regulate MMP13, and improve the degeneration of OA through weakening the oxidative stress responses and inhibiting the degradation of cartilage extracellular matrix [15]. However, the mechanism of action of QUE in the treatment of OA is still unclear. Recent studies have shown that QUE modulates chondrocyte autophagy in KOA by activating TSC2-RHEB-mTOR [16].

Autophagy regulates cell differentiation, survival, death, aging and other physiological functions [17]. When a cell faces a malignant stress environment such as energy deficiency, hypoxia and inflammation, it uses its own intracellular lysosomes to degrade damaged and discarded organelles or macromolecules in the cytoplasm into small molecules such as glucose, amino acids, free fatty acids, etc., and resupply them to the cell for recycling, a process called autophagy, which is a normal protective mechanism for eukaryotes in the face of adverse environments [8]. The role of autophagy can be summarized in two aspects: on the one hand, cells can eliminate necrotic and aggregated proteins as well as bacteria, viruses or other pathogens in the body through autophagy and perform self-purification; on the other hand, the proteins or pathogens eliminated by autophagy can be converted into nutrients and energy for cell survival. Autophagy, a genetically regulated process of cellular energy metabolism, has been shown to be an important protective mechanism for articular cartilage [16]. The occurrence of chondrocyte death and OA is associated with reduced autophagic activity [9], in line with this finding, Carames B et al. [18] found that chondrocyte autophagy levels were significantly decreased in OA patients, accompanied by reduced expression of ULK1, Beclin1, and LC3 proteins, and the same occurred in a mouse model of OA. So, autophagy is essential for maintaining chondrocyte function, that autophagy is essential for maintaining the integrity and function of articular cartilage, and that reduced autophagic activity leads to the development of OA. Recently, it has been found that AMPK can improve the stress resistance and survival of chondrocytes by regulating the activity of its downstream target molecules in articular chondrocytes, and plays an important role in the development of OA [19]. The AMPK/mTOR/ULK1 pathway-based targeting to regulate chondrocyte autophagy to restore chondrocyte function and prolong their lifespan, thereby delaying the progression of OA has been demonstrated, for example, by Zhang et al [20], who first demonstrated that cartilage-specific ablation of mTOR resulted in increased autophagic signaling and significant protection against medial meniscal instability in a mouse model of OA, thereby significantly attenuated articular cartilage degradation, apoptosis and synovial fibrosis, suggesting that the regulation of ULK1/AMPK signaling pathway by mTOR may be partially responsible for regulating autophagic signaling and the balance between catabolic and anabolic factors in articular cartilage, protecting rats from OA. Zhao et al. [21] showed that the mRNA expression levels of IL-6 and TNF-α were suppressed in chondrocytes stimulated with IL-1β by ozone treatment, and ozone increased the mRNA levels of TIMP-1 and decreased MMP-13 mRNA levels in IL-1β-stimulated chondrocytes. These results suggest that ozone can improve the autophagy level of IL-1β-stimulated chondrocytes by activating the AMPK/mTOR pathway, inhibiting inflammation, and helping maintain the metabolic homeostasis of IL-1β-stimulated chondrocytes. AMPK/mTOR/ULK1 signaling pathway has become a hot spot for studying OA chondrocyte autophagy and a new research target for drug treatment of OA [22, 23]. Unfortunately, the mechanism of whether QUE regulates autophagy to retard the progression of OA by regulating the AMPK/mTOR/ULK1 signaling pathway is not clear. So, this study explored the molecular mechanism of QUE for OA treatment based on this signaling pathway.

Based on these studies, in this study, we examined the therapeutic effects of QUE on LPS-induced chondrocytes mimicking an OA-like cell model and confirmed the role of QUE in regulating chondrocyte autophagy by mediating the AMPK/mTOR/ULK1 signaling pathway. This will help to further explore the pathogenesis of OA and the action targets of QUE, and provide theoretical and experimental basis for the prevention and treatment of OA.

Reagents

QUE (Q4951, USA) was purchased from sigma. Lipopolysaccharide (LPS) (L8880, China), Collagenase II (C8150, China), Toluidine blue (G3660, China) was purchased from Solarbio. Dulbecco’s modified Eagle’s medium (DMEM)‐F12 medium (SH30023.01, USA) and phosphate‐buffered saline (PBS) (SH300256.01, USA) were purchased from Hyclone. Fetal bovine serum (FBS) (10099141C, AUS), 0.25% trypsin (25200072, AUS) were purchased from GIBCO. Cell Counting Kit 8 assay (CCK8) (40203ES0, China) were purchased from YEASEN. Lyso-Tracker Red (C1046, China) were purchased from Beyotime. Enzyme‑linked immunosorbent assay (ELISA) kit for human 1L‑1β (MM-0181H1, China) and ELISA kit for human TNF‑α (MM-0122H1, China) were purchased from FEIYA BIOTECHNOLOGY. Cell cycle staining Kit (CCS012, China) were purchased from MULTI SCIENCES. Annexin V-FITC/PI cell apoptosis detection Kit (MA0220, China) were purchased from meilunbio. Goat Anti-Rabit IgG (H&L)-Alexa Fluor 488 (RS3211, USA) were purchased from Immunoway. compound C (Com C) (HY-13418A, USA) were purchased from MCE, Collagen type II (Collagen Ⅱ) (GTX127375, USA) were purchased from Gene Tex. First Strand cDNA Synthesis kit (11141ES60, China), Fluorescence quantification kit (11141ES60, China), Total RNA Extraction Kit (19221ES50, China) were purchased from YEASEN.

Methods

Cartilage explant and chondrocyte isolation

Human articular cartilage was obtained with implicit consent as waste material from patients undergoing total knee replacement surgery 5 females, 5 males, 65±10 years). This protocol was approved by the Medical Ethical Committee of the Gansu Provincial Hospital of Traditional Chinese Medicine, Lanzhou, protocol number 2020-136-01. Full thickness cartilage was removed from the articular surface of the tibial plateau or lower femur and washed three times with 0.9% NaCl (Sichuan Kelun Pharmaceutical Co., Ltd, China). To isolate chondrocytes, cartilage chips was cut into 1mm³ pieces, washed 3 times with PBS, transferred into a sterile centrifuge tube, added 4 times the volume of 0.2% type II collagenase solution and 1 times the volume of 0.25% trypsin solution, placed in a 37℃ shaker incubator and digested with slight shaking until the cartilage tissue pieces basically disappeared and the solution became cloudy, then centrifuged for 5 min at 1000rpm/min. The cells were washed twice with PBS, and the supernatant was discarded. The isolated chondrocytes were expanded in monolayer at a seeding density of 2x10⁵/ml in DMEM high glucose supplemented with 10% fetal bovine serum, 100 U/mL penicillin and 100 U/mL streptomycin (Solarbio, China) and incubated at 37℃ in a 5% CO₂ incubator. Approximately 80% of confluency cells were trypsinized and reseeded at 2x105/ml. Cells were used for experiments after 3 passages.

Toluidine blue staining

Primary chondrocytes of the knee joint were taken and inoculated into a 6‑well plate at 5x10⁴cells/well. When the number of cells reached more than half of the area, 4% paraformaldehyde was used to fix them at room temperature for 30 min. After rinsing for 5 min, the toluidine blue dye solution was added evenly, and after staining at room temperature for 15 min, distilled water and PBS buffer solution were rinsed until dark blue disappeared. Finally, an appropriate amount of ultrapure water was added and then observed microscopically (10x Magni-fication, ECLIPSE Ts2 inverted phase contrast microscope, Nikon, Japan).

Optimal intervention concentration of LPS and QUE screened by CCK‑8

Inoculation density of cells was 1x10⁵ cells /well, for each group of three wells. LPS medium at different concentrations (0, 2.5, 5, 7.5, 10 and 12.5µg/ml) was added to the drug group, respectively. After 24, 48 and 72 hours of intervention, respectively, 10 µl of CCK-8 solution was added to each well and incubated at 37°C for 2 hours. The OD value of each well was detected at 450 nm. The normal complete culture medium was used in the blank group. After moulding according to the appropriate concentration determined by LPS, the QUE was added to each well at 0μmol/ml, 50μmol/ml, 100μmol/ml, 150μmol/ml and 200μmol/ml, respectively. After 12, 24 and 48 hours of intervention, respectively, 10 µl of CCK-8 solution was added to each well and incubated at 37°C for 2 hours. The OD value of each well was detected at 450 nm.

Experimental grouping and intervention

All groups except the control group were treated with 10µg/ml LPS and cultured for 48 h at 37˚C in a humidified atmosphere containing 5% CO2. After successful intervention, normal complete medium was added to control group and cultured for 48 h, complete medium containing 100μmol/ml QUE was added to QUE group and cultured for 24 h, complete medium containing 100nmol/ml 3-MA was added to 3-MA group and cultured for 12 h, complete medium containing 100nmol/ml 3-MA was added to 3-MA+QUE group and cultured for 12 h, then 100μmol/ml QUE was added for 24 h, complete medium containing 5µmol/ml compound C (com C) was added to Com C group and cultured for 12 h, complete medium containing 5µmol/ml com C was added to Com C+QUE group and cultured for 12 h, then 100μmol/ml QUE was added for 24 h.

Quantitative real-time polymerase chain reaction (qRT-PCR)

After treatments, total RNA from chondrocytes was extracted by using the Trizol (YEASEN, China) according to the manufacturer’s instructions. The concentration of each RNA sample that was detected by Ultra-micro UV-Visible Spectrophotometer (Bio Teke, China), after which, the RNA samples were stored at -80 ℃ for preparation. The primers used for RT-PCR were designed in accordance with the nucleotide sequence of LC3Ⅱ and P62 in Gen bank by BLAST, and the results are shown in Table 1. The primer pairs were synthesized by Sangon Biotech. The RT-PCR assay was performed using the reverse transcription kits provided by YEASEN, and with the final volume of 20μl including 10μl 2 X SYBR Green QPCR master mixes, 0.4μl for each primer (10μmol/l), 0.3μl diluted Reference Dye and 0.3μl cDNA with addition of 9ml DEPC water. PCR reactions were carried out in circulations, pre-denaturation at 95 ℃ for 10 min, followed by 40 circulations of denaturation at 95 ℃ for 30 s, annealing at 58 ℃ for 1 min and extension at 72 ℃ for 30 s. The GAPDH gene was used as the reference gene. Averaged CT values (amplification power curve inflection point) were analyzed and targeted gene expression levels were calculated using the formula 以2^-^△△^Ct.

Table. 1

Sequences of the primers

PCR primers sequences	Forward (5'-3')	Reverse (5'-3')
LC3 Ⅱ	ACCCTGAGTCTTCTCTTCAGGT	GTTGCGCTTCACAACTCAGG
P62	TGAGGAACAGATGGAGTCGGA	TCGGATTCTGGCATCTGTAGG
GAPDH	CAGGAGGCATTGCTGATGAT	GAAGGCTGGGGCTCATTT

Western blotting

After treatments, the cells were washed three times with PBS and collected with RIPA lysis buffer (Solarbio, China) containing phosphatase and protease inhibitor cocktail (Solarbio, China) on ice for 2 h. Then, the total protein concentration was detected by Ultra-micro UV-Visible Spectrophotometer (Bio Teke, China). Equal amounts of protein were separated by 6–12% SDS-PAGE and transferred to polyvinylidene (PVDF) membranes (Millipore, USA). 5% bovine serum albumin (BSA) (Solarbio, China) was used to block the membranes. After 60 min, the PVDF membranes were incubated with primary antibodies overnight at 4 °C. After that, the membranes were washed with tris buffered saline tween (TBST) three times and incubated with specific secondary antibodies at room temperature for 1 h. Finally, the enhanced chemiluminescence solution (ECL, 36208ES60, YEASEN, China) was added to the band and the strip was visualized by the detection system (Bio-RAD, CA, USA). Image J. (1.8.0, National Institutes of Health, Germany) was used to analyze the gray value of the strip. The primary antibodies used in this study are listed: MMP13 (GTX100665, 1:1000, Gene Tex, USA), LC3 Ⅱ (GTX100829, 1:1000, Gene Tex, USA), P62 (GTX100685, 1:1000, Gene Tex, USA), TIMP1 (YT4658, 1:1000, Immunoway, USA), Bcl-2 (YM3041, 1:300, Immunoway, USA), Bax (YM3619, 1:300, Immunoway, USA), Beclin-1 (YM3655, 1:1000, Immunoway, USA), AMPK (YT0216, 1:1000, Immunoway, USA), P-AMPK (YP0575, 1:1000, Immunoway, USA), mTOR (YT02913, 1:1000, Immunoway, USA), P-mTOR (YP0176, 1:1000, Immunoway, USA), β-actin (YM3028, 1:10000, Immunoway, USA), HRP* Goat Anti-Rabit IgG (H+L) (RS0002, 1:10000, Immunoway, USA), P-ULK-1 (AP1005, 1:1000, Biogot, China).

Immunofluorescence staining

Primary chondrocytes of the knee joint were taken and inoculated into a 24‑well plate at 1x10⁴ cells/well. When the number of cells reached more than half of the area, 4% paraformaldehyde was used to fix them at room temperature for 30 min. After fixation, the cells were penetrated with 0.5% Triton X-100 for 30 min and blocked with 5% BSA at room temperature for 60 min. After that, the cells were incubated with specific primary antibodies for Collagen Ⅱ at 4 °C overnight. Then the cells were rinsed with cold PBS and incubated with fluorescence-conjugated secondary antibodies for 60 min in the dark. Finally, DAPI was used to stain cell nuclei for 5 min. The images of Collagen Ⅱ were captured by fluorescence microscopy (Nikon, Japan).

After treatments, experimental procedure as before. The primary antibodies used in this study are listed: MMP13, LC3 Ⅱ, P62, TIMP1, Beclin-1, P-AMPK, P-mTOR (1:500).

Lyso-Tracker Red was used according to the manufacturer’s protocol. Configuration of Lyso-Tracker Red working solution: add Lyso-Tracker Red to the complete medium at a ratio of 1:15000 to make a final concentration of 50-75 nmol/ml, to be incubated at 37 °C before use. Lysosomal fluorescence labeling: After treatment, add pre-prepared Lyso-Tracker Red working solution and incubate at 37°C for 30 min; remove the Lyso-Tracker Red working solution and add fresh complete medium; subsequently observe with fluorescence microscope, a bright strong fluorescent staining of lysosomes can be observed.

Transmission electron microscope (TEM)

After treatments, fixed the cells with glutaraldehyde for transmission electron microscope analysis to detect autophagosomes. Transmission electron microscope (HITACHI, JEM-1400PLUS, Japan) was used to collect the corresponding images.

Flow cytometry

After treatment, the cells were washed twice in cold PBS, the cells were added with 1ml DNA Staining solution and 10μl Permeabilization solution, and mixed by vortex shaking for 5-10 seconds. Incubate for 30 min at room temperature and protected from light to determine the distribution of cell cycle.

After treatments, the cells washed twice in cold PBS, the cells were resuspended in 100μl 1XBinding buffer. Next, 5μl of FITC Annexin V and propidium iodide (PI) were added, and the cells were incubated for 15 min at room temperature protected from light. Subsequently, 400μl of 1XBinding buffer was added to each tube, and the apoptotic rate of chondrocytes was examined at once by a FACSCalibur flow cytometer (BD Biosciences, USA).

ELISA for detecting IL‑1β and TNF‑α

Standard samples with 2X diluted standard were added to the standard wells in turn, cell culture medium was added to the blank wells, and buffer (1X) and samples were added to the sample wells, with four samples in each group. The treated detection antibody was added to each well, the plate was sealed, and the samples were incubated whilst shaking at room temperature for 2 h. After all the samples were washed, horseradish peroxidase‑labeled streptomycin was added to each well, and the samples were incubated at room temperature for 45 min. The plate was washed. Then, after the color‑rendering substrate, TMB was added to 96 orifice plate, the samples were cultured at room temperature for 20 min, avoiding light. OD value at 450 nm wavelength was measured within 30 min by an enzyme marker.

Statistical analysis

All quantitative data are presented as the means±standard deviation (SD). SPSS 24.0 software was utilized to perform statistical analysis. One-way ANOVA and Student's t-test were utilized to analyze the significant differences between groups, and P<0.05 was considered to be statistically significant.

Extraction and identification of articular chondrocytes in humans

In the present study, toluidine blue staining and Collagen II immunofluorescence staining were used to identify articular chondrocytes isolated from articular cartilage tissues in humans. As shown in Fig. 1, the primary cells were oval, round or short spindle shaped at 24h post-inoculation against the wall, and chondrocytes were continued to be cultured for 7-10 d in a "pavement stone" like. The 3rd generation cells grew rapidly and the cell phenotype was stable. Therefore, the 3rd generation chondrocytes were selected for subsequent studies in this experiment. After staining with toluidine blue, the nuclei were stained dark blue and the cytoplasm and stroma were stained light blue (Fig. 1D-F). After staining with Collagen II immunofluorescence, the cytoplasm and cytosol were stained clear green fluorescence, and the nuclei were stained blue fluorescence, and Collagen II was positively expressed in more than 95% of the cells (Fig. 1G).

Effects of LPS and QUE on chondrocyte viability

The optimal concentration of LPS intervening with chondrocytes was screened by CCK‑8(Fig. 2A). As detected, the cellular activity decreased continuously with time for each concentration gradient of LPS, and the cellular activity decreased significantly when the LPS concentration was ≥10μg/ml and time ≥48 h. Considering the toxic effect of LPS on chondrocytes, the LPS concentration of 10μg/ml and 48 h was selected for the follow-up experiments. Thus, LPS at the concentration of 10μg/ml and 48 h could induce the degeneration of chondrocytes, and the model was successfully established. The optimal concentration of QUE in intervening with chondrocytes was screened by CCK‑8(Fig. 2B). The cell viability of the model group was significantly lower compared with that of the control group for 12, 24 and 48 h, respectively, and the difference was statistically significant. At the same time, compared with the cell viability of degenerative chondrocytes of the model group, the increase in cell viability of the 100 µmol/ml and 48 h quercetin intervention group was significant for 12, 24 and 48 h, respectively, which shows that the optimal concentration of quercetin is 100 µmol/ml and 48 h, and the difference was statistically significant.

Effects of quercetin on the expressions of autophagy-related genes in LPS-induced chondrocytes

The chemical structure of QUE was shown in Fig. 3A. Autophagy of chondrocytes is the prime method to protect joints. In order to verify the effect of QUE on autophagy, the autophagy inhibitor 3-MA was introduced to treat chondrocytes, qRT-PCR was performed to detect the expressions of autophagy-related genes in LPS-induced chondrocytes. Compared with Control group, the mRNAs expressions of LC3 II in LPS-induced chondrocytes were decreased, while those of P62 were enhanced (Fig. 3B, C). QUE treatment could significantly reverse the mRNA expressions of LC3 II and P62 in LPS-induced chondrocytes (Fig. 3B, C). However, when QUE is used in combination with the blocker (3-MA), partially reverse the mRNA expressions of LC3 II and P62 in LPS-induced chondrocytes. Treatment with 3-MA alone does not reverse the mRNA expressions of LC3 II and P62 in LPS-induced chondrocytes (Fig. 3B, C), indicating that 3-MA could prevent QUE from activating autophagy in LPS-induced chondrocytes.

QUE reversed apoptosis, inflammation and cartilage matrix degradation in LPS-induced chondrocytes by autophagy-based

Western blotting analysis was used to detect the protein expression levels of Bcl-2, Bax, MMP13, TIMP1 in each group (Fig. 3 D, E, F, G and H). Results showed that compared with Control group, the proteins expressions of TIMP1 and the ratio of Bcl-2/Bax were decreased in LPS-induced chondrocytes, while those of MMP13 were enhanced, and the difference was statistically significant. QUE treatment could significantly reverse the proteins expressions of MMP13, TIMP1 and the ratio of Bcl-2/Bax in LPS-induced chondrocytes. However, when QUE was used in combination with the 3-MA, partially reversed the proteins expressions of MMP13, TIMP1 and the ratio of Bcl-2/Bax in LPS-induced chondrocytes, Treatment with 3-MA alone did not reverse the proteins expressions of MMP13, TIMP1 and the ratio of Bcl-2/Bax in LPS-induced chondrocytes. Likewise, the result of ELISA demonstrated that the expression levels of inflammatory factors, IL‑1β and TNF‑α in LPS-induced chondrocytes were higher in Model group than that in Control group, while QUE could reverse the expressions of IL‑1β and TNF‑α in LPS-induced chondrocytes. However, when QUE was used in combination with the 3-MA, partially reversed the proteins expressions of IL‑1β and TNF‑α in LPS-induced chondrocytes. Treatment with 3-MA alone did not reverse the proteins expressions of IL‑1β and TNF‑α in LPS-induced chondrocytes (Fig. 3 I, J), indicating that 3-MA could prevent QUE from reversed apoptosis, inflammation and cartilage matrix degradation in LPS-induced chondrocytes. Meantime, indicating that QUE could suppress apoptosis, inflammation and cartilage matrix degradation in LPS-induced chondrocytes by autophagy-based.

Expression levels of associated proteins by targeting AMPK/mTOR/ULK1 signaling pathway via QUE

Western blotting analysis was used to detect the expression levels of associated proteins AMPK, P-AMPK, mTOR, P-mTOR and P-ULK1 in the AMPK/mTOR/ULK1 signaling pathway of chondrocytes in each group (Fig. 4 A, B, C and D). Results showed that compared with Control group, the proteins expressions of P-AMPK and P-ULK1 were decreased in LPS-induced chondrocytes, while those of P-mTOR were enhanced. We found QUE treatment could significantly reverse the proteins expressions of P-AMPK, P-mTOR and P-ULK1 in LPS-induced chondrocytes. However, when QUE was used in combination with the blocker (com C), partially reversed the proteins expressions of P-mTOR and P-ULK1, but couldn't reverse the protein expression of P-AMPK in LPS-induced chondrocytes. Treatment with com C alone did not reverse the proteins expressions of P-AMPK, P-mTOR and P-ULK1 in LPS-induced chondrocytes. Similarly, Immunofluorescence staining detection of P-AMPK, P-mTOR and P-ULK1 protein expression trends were consistent with Western blotting results (Fig. 4 E, F and G). The results demonstrated that QUE regulated proteins of the AMPK/mTOR/ULK1 signaling pathway in LPS-induced chondrocytes.

QUE regulates autophagy of LPS-induced chondrocytes through targeting AMPK/mTOR/ULK1 signaling pathway

To investigate whether QUE affects the autophagy of LPS-induced chondrocytes by targeting AMP-K/mTOR/ULK1 signaling pathway. Western blotting was performed to detect the expressions of autophagy-related proteins in LPS-induced chondrocytes (Fig. 5 A, B, C and D). Results showed that compared with Control group, the proteins expressions of LC3Ⅱ and Beclin-1 were decreased in LPS-induced chondrocytes, while those of P62 were enhanced. We found QUE treatment could significantly reverse the proteins expressions of LC3Ⅱ, P62 and Beclin-1 in LPS-induced chondrocytes. However, when QUE was used in combination with the com C, partially reversed the proteins expressions of LC3Ⅱ, P62 and Beclin-1 in LPS-induced chondrocytes. Treatment with com C alone did not reverse the proteins expressions of LC3Ⅱ, P62 and Beclin-1 in LPS-induced chondrocytes. Similarly, Immunofluorescence staining detection of LC3Ⅱ, P62 and Beclin-1 proteins expression trends were consistent with Western blotting results (Fig. 5 E, F and G). Next, from the transmission electron microscope (TEM) images and Lyso-Tracker Red staining, the autophagosome and the lysosome were dramatically increased in the QUE group compared with Model group. However, when QUE was used in combination with the com C, partially effect the autophagosome and the lysosome production in LPS-induced chondrocytes. Treatment with com C alone did not effect the autophagosome and the lysosome production in LPS-induced chondrocytes (Fig. 5 H, I, J and K). These results indicated that the QUE could increase autophagy flux and autophagosome and lysosome production of LPS-induced chondrocytes Through Targeting AMPK/mTOR/ULK1 signaling pathway.

The effect of QUE activated autophagy on cell apoptosis and proliferation in LPS-induced chondrocytes through targeting AMPK/mTOR/ULK1 signaling pathway

To investigate whether the effect of QUE activated autophagy on cell apoptosis and cell proliferation in LPS-induced chondrocytes through targeting AMP-K/mTOR/ULK1 signaling pathway. Western blotting analysis was used to detect the proteins expression levels of Bcl-2, Bax, in each group (Fig. 6 A, B). Results showed that compared with Control group, the ratio of Bcl-2/Bax were decreased in LPS-induced chondrocytes, and the difference was statistically significant. QUE treatment could significantly reverse the proteins expressions of Bcl-2, Bax in LPS-induced chondrocytes. However, when QUE was used in combination with the com C, partially reversed the proteins expressions of Bcl-2, Bax in LPS-induced chondrocytes, Treatment with com C alone did not reverse the proteins expressions of Bcl-2, Bax in LPS-induced chondrocytes. Furthermore, Flow cytometry results also showed that the apoptosis rate markedly enhanced in the Model group (16.47%) compared with that of the control group (5.99%), while QUE could decreased the apoptosis rate (6.43%) in LPS-induced chondrocytes. However, when QUE was used in combination with the com C, partially decreased the apoptosis rate (11.10%) in LPS-induced chondrocytes. Treatment with com C alone did not reverse the apoptosis of LPS-induced chondrocytes (Fig. 6 E, F). The cell cycle distribution was analyzed by Flow cytometry analysis (FCM) as shown in Fig. 6 C, D. The data showed that the S and G2 phase proportion of QUE group(10.20%) and Com C+QUE group increased compared with Model group (2.36%), but QUE group was the highest, and the S and G2 phase proportion of Com C group (5.23%) was no statistical difference compared with Model group in LPS-induced chondrocytes. The G1 phase cell numbers were Control group (88.50%), Model group (97.60%), QUE group (89.90%), Com C group (94.4%) and Com C+QUE group (91.70%), respectively. It is suggested that the QUE activated autophagy could promote cells from G1 phase to S, G2 phase and inhibit apoptosis in LPS-induced chondrocytes through targeting AMPK/mTOR/ULK1 signaling pathway.

The effect of QUE activated autophagy on inflammation and cartilage matrix degradation in LPS-induced chondrocytes through targeting AMPK/mTOR/ULK1 signaling pathway

To investigate whether the effect of QUE activated autophagy on inflammation and cartilage matrix degradation in LPS-induced chondrocytes through targeting AMPK/mTOR/ULK1 signaling pathway. Western blotting analysis, ELISA were used to detect the proteins expression levels of inflammation and cartilage matrix degradation, such as, TIMP1, MMP13, IL-1β and TNF-α, in each group. Results showed that compared with Control group, the proteins expressions of TIMP1 was decreased in LPS-induced chondrocytes, while those of MMP13, IL-1β and TNF-α were enhanced. We found QUE treatment could significantly reverse the proteins expressions of TIMP1, MMP13, IL-1β and TNF-α in LPS-induced chondrocytes. However, when QUE is used in combination with the com C, partially reversed the expressions of TIMP1, MMP13, IL-1β and TNF-α in LPS-induced chondrocytes. Treatment with com C alone did not reverse the expressions of TIMP1, MMP13, IL-1β and TNF-α in LPS-induced chondrocytes. Similarly, Immunofluorescence staining detection of TIMP1, MMP13 proteins expression trends were consistent with Western blotting results (Fig.7 A-G). These results demonstrated that QUE activated autophagy regulated proteins of the inflammation and cartilage matrix degradation in LPS-induced chondrocytes through targeting AMPK/mTOR/ULK1 signaling pathway.

OA is a common degenerative joint disease characterized by degradation of cartilage, inflammatory hyperplasia at the joint edges and superfluous apoptosis of chondrocytes, and increased joint wear and tear, which leads to pain and functional loss. With the aggravation of the aging of the world population, the incidence of OA has continued to rise, bringing a heavy economic burden to the entire society [24]. Despite various therapeutic strategies having been tested and proposed, their actual effectiveness has not been established [25]. At present, there are no disease-modifying drugs with evidently validated therapeutic effects to modify the progression of OA [3]. Thus, exploring a better treatment for OA has been the focus of orthopaedic research. Although the pathogenesis of OA is not yet clear, it is generally believed that autophagy is essential for maintaining chondrocyte function, and a decrease in autophagic activity leads to the development of OA [8]. As an important role in the pathogenesis of OA, autophagy has been attracted intensive attention to be a target for new OA treatment. The development of safe and effective drugs that can enhance autophagic activity or restore autophagy flux is a promising strategy for the treatment of OA [6]. Autophagy as a cytoprotective mechanism to reduce the damaged organelles or degraded macromolecules in cells [26]. In the process of OA, chondrocytes have reduced autophagic activity and reduced ability to remove their own senescent and damaged organelles and inflammatory factors, resulting in an inflammatory cellular response and promoting chondrocyte damage and apoptosis [27].

QUE, widely found in fruits, vegetables, and Chinese herbal medicines, has anti‑inflammatory and anti‑oxidative stress effects [1]. According to the existing research, QUE may have a protective effect on the articular cartilage of OA. Wang et al. reported that based on the data from network pharmacology and in vitro experiments, it was demonstrated that QUE could lower the expression of inflammatory factors of cartilage for the prevention and treatment of OA [1]. Li et al. [14] reported that QUE alleviates OA progression in rats by suppressing inflammation and apoptosis via inhibition of IRAK1/NLRP3 signaling. Wei et al. [28] demonstrated that QUE could improve the degenerative effects of OA by attenuating oxidative stress responses and inhibiting the degradation of cartilage extracellular matrix. Unfortunately, QUE effects and underlying mechanisms suppresses apoptosis, inflammation and cartilage matrix degradation has not been thoroughly studied on OA. Autophagy of chondrocytes is the prime method to protect joints. We found that QUE could enhance the mRNA expressions of LC3 II and inhibit the mRNA expressions of P62 in LPS-induced chondrocytes (Fig. 3B, C), with the result indicating that QUE can promote autophagy of LPS-induced chondrocytes.

OA is a multi-level, all-round chronic inflammatory disease involving subchondral bone, synovial membrane, joint capsule and other structures, with chronic inflammation, degenerative cartilage changes and pain as its main pathological features. The inflammatory factors produced during the inflammatory response in OA act directly on the articular cartilage on the one hand, causing structural changes in the cartilage and thus degeneration, and on the other hand, accelerating the development of OA by affecting chondrocyte metabolism and producing cytokines and proteases related to mediating the inflammatory response and related cascade reactions to accelerate the destruction of articular cartilage [29–32] IL-1β and TNF-α play an important role in degeneration of OA articular cartilage, and they play a key role in inflammatory lesions, degradation of cartilage extracellular matrix and altered chondrocyte function in OA, and are initiating factors in regulating the inflammatory response [33]. Marks et al. [34] found that the levels of IL-1β and TNF-α were significantly elevated in the joint fluid of OA patients and were positively associated with articular cartilage degeneration. MMPs are the main extrachondral matrix degrading enzymes, while MMP-13 is the main degrading enzyme of the MMPs family for the degradation Collagen II, and the up-regulation of MMP-13 expression promotes the collagen matrix degradation process [35], leading to articular cartilage degeneration. In contrast, metalloproteinase inhibitor-1 (TIMP-1) can form a TIMP-MMPs complex, which reduces the number of MMP-13 monomers and inhibits collagen matrix degradation, and MMPs and TIMPs combine in a specific ratio to maintain the balance between synthesis and degradation of the extrachondral matrix, thus maintaining the structure and function of cartilage, and the results of its expression and interaction directly determine the metabolism of the extrachondral matrix, which in turn affects cartilage structure and function [36]. The inflammatory factors IL-1β and TNF-α play an important role in presenting and stimulating chondrocytes to produce cartilage matrix MMPs to promote the disruption of cartilage matrix synthesis and metabolism in the joint, which in turn promotes cartilage degeneration and ultimately triggers OA, TIMP1 acts as an anti-matrix catabolic agent and binds isotopically to activated MMPs, thus preventing the overexpression of MMPs, which in turn stimulates chondrocyte proliferation and maintains a normal state of cartilage extracellular matrix metabolic transformation [37]. We found that the expression of MMP13, IL‑1β and TNF‑α were enhanced and the expression of TIMP1 was decreased in LPS-induced chondrocytes; moreover, QUE could reverse the inflammation and cartilage matrix degradation in LPS-induced chondrocytes (Fig. 3I, J). In the meantime, Bcl-2 and Bax play an important role in apoptosis. Bax is the main pro-apoptotic protein that often exists as an inactive monomer in cells, and when it receives apoptosis activation signal, its structure is changed to oppose the anti-apoptotic protein Bcl-2 and inhibit the anti-apoptotic effect of Bcl-2 [38, 39]. However, when the relative content of Bcl-2 is greater than Bax, Bcl-2/Bax heterodimers are formed to neutralize Bax protein, while Bcl-2 homodimers are increased, thus inhibiting apoptosis and improving cell survival. In the present study, QUE remarkably enhanced the ratio of Bcl-2/Bax in LPS-induced chondrocytes (Fig. 3D and E). Collectively, QUE could reverse apoptosis, inflammation and cartilage matrix degradation in LPS-induced chondrocytes.

In order to verify QUE suppresses apoptosis, inflammation and cartilage matrix degradation in LPS-induced chondrocytes by autophagy-based, the autophagy inhibitor 3-MA was introduced to treat chondrocytes found that QUE enhanced the proteins expressions of TIMP1, Bcl-2 and inhibited the expressions of MMP13, Bax, P62, IL-1β and TNF-α in LPS-induced chondrocytes (Fig. 3D, E-J), with the result indicating that QUE could reverse apoptosis, inflammation and cartilage matrix degradation in LPS-induced chondrocytes by autophagy-based. However, when QUE was used in combination with 3-MA, partially reverse the proteins expressions of TIMP1, Bcl-2, MMP13, Bax, P62, IL-1β and TNF-α in LPS-induced chondrocytes, indicating that 3-MA could prevent QUE from reversed apoptosis, inflammation and cartilage matrix degradation in LPS-induced chondrocytes. Therefore, indicating that QUE also inhibits apoptosis, inflammation and cartilage matrix degradation through other pathways in LPS-induced chondrocytes.

The AMPK/mTOR/ULK1 signaling pathway is the classical signaling axis that induces autophagy [22]. AMPK is widely present in eukaryotic cells to maintain intracellular energy homeostasis, and recent studies have revealed that AMPK can improve chondrocyte stress resistance and survival by regulating the activity of its downstream target molecules in articular chondrocytes, playing an important role in the development of OA [19, 40]. mTOR is an important signaling protein downstream of the AMPK pathway that plays a negative regulatory role in autophagy [41, 42]. ULK1 is a downstream target of mTOR and a marker of autophagy initiation, and inactivation of ULK1 kinase inhibits autophagy [43]. Phosphorylation of the mTOR complex-mTORC1 component Raptor and tuberous sclerosis protein2 (TSC2) are two pathways that inhibit mTOR activity, thereby unlocking the inhibitory effect of mTOR on ULK1 [44]. Sheng et al. [45] found that knockout of AMPKα gene in rats promoted the degeneration of KOA in rats. Li J et al. [46] found that metformin protected articular cartilage in an OA rat model by activating the AMPK signaling pathway. We also found that QUE could regulate the AMPK/mTOR/ULK1 signaling pathway in LPS-induced chondrocytes (Fig. 4). To investigate whether QUE affects the autophagy of LPS-induced chondrocytes by targeting AMPK/mTOR/ULK1 signaling pathway, the AMPK inhibitor com C was introduced to treat chondrocytes found that QUE treatment could significantly reverse the proteins expressions of LC3Ⅱ, P62, Beclin-1, and the autophagosome and lysosome production in LPS-induced chondrocytes. However, when QUE was used in combination with the blocker, partially reverse the protein expressions of LC3Ⅱ, P62, Beclin-1, and the autophagosome and lysosome production in LPS-induced chondrocytes. These results indicated that the QUE could increase autophagy flux and autophagosome and lysosome production of LPS-induced chondrocytes Through Targeting AMPK/mTOR/ULK1 signaling pathway. But, indicating that QUE also activates autophagy through other pathways in LPS-induced chondrocytes. Next, we found that QUE treatment could significantly reverse the expressions of Bcl-2, Bax, TIMP1, MMP13, IL-1β and TNF-α in LPS-induced chondrocytes, and the QUE could promote cells from G1 phase to S, G2 phase and inhibit apoptosis in LPS-induced chondrocytes (Fig. 6, 7). However, QUE + Com C group partially suppresses apoptosis, proliferation, inflammation and cartilage matrix degradation in LPS-induced chondrocytes. In summary, our results showed that the QUE activates autophagy could suppress apoptosis, proliferation, inflammation and cartilage matrix degradation in LPS-induced chondrocytes through targeting AMPK/mTOR/ULK1 signaling pathway. Also, QUE activates autophagy alleviated LPS-induced chondrocytes injuries through other pathways in LPS-induced chondrocytes. Unfortunately, the present study only explored the mechanism of QUE regulation of AMPK/mTOR/ULK1 signaling axis to activate LPS-induced chondrocyte autophagy on LPS-induced chondrocytes at the cellular level, lacking evidence from animal experimental studies. The efficacy of QUE in comparison with other phytochemical compounds used in the treatment of OA needs more experimental analyses.

Our study proves that QUE is effective in treating OA. In addition, we found that QUE can regulate autophagy of LPS-induced chondrocytes through the AMPK/mTOR/ULK1 signaling pathway, which further inhibits the cell apoptosis, inflammation and cartilage matrix degradation of LPS-induced chondrocytes (Fig. 8). Our study highlights the therapeutic effect of QUE on OA and also demonstrates the specific mechanism of QUE, with the results putting forward a reliable theoretical basis for the treatment of OA with QUE.

Acknowledgements

Not applicable.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Authors’ contributions

LSH conceived, organized, and supervised the study; XB and WL performed the experiments and contributed to the analysis of data, XB and LSH prepared and wrote the manuscript.

Ethics approval and consent to participate

This protocol was approved by the Medical Ethical Committee of the Gansu Provincial Hospital of Traditional Chinese Medicine, Lanzhou, protocol number 2020-136-01.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interest.

Wang XP, Xie WP, Bi YF, et al. Quercetin suppresses apoptosis of chondrocytes induced by IL-1β via inactivation of p38 MAPK signaling pathway. Exp Ther Med. 2021; 21(5): 468.
Yan BZ, Luo D, Li JC, Liang XZ, Xu B, Li G. Molecular mechanism of Wutou Decoction in the treatment of osteoarthritis: a bioinformatics and molecular docking study. Ann Palliat Med. 2021; 10(7): 7706-7720.
Hu Y, Gui Z, Zhou Y, Xia L, Lin K, Xu Y. Quercetin alleviates rat osteoarthritis by inhibiting inflammation and apoptosis of chondrocytes, modulating synovial macrophages polarization to M2 macrophages. Free Radic Biol Med. 2019; 145: 146-160.
Vina ER, Kwoh CK. Epidemiology of osteoarthritis: literature update. Curr Opin Rheumatol. 2018; 30(2): 160-167.
Frank M, Bwemero J, Kalunga D, et al. OA60 Public health and palliative care mix; a ccpmedicine approach to reverse the overgrowing burden of non-communicable diseases in tanzania. BMJ Support Palliat Care. 2015; 5 Suppl 1: A19.
Loeser RF. The Role of Aging in the Development of Osteoarthritis. Trans Am Clin Climatol Assoc. 2017; 128: 44-54.
O'Neill TW, McCabe PS, McBeth J. Update on the epidemiology, risk factors and disease outcomes of osteoarthritis. Best Pract Res Clin Rheumatol. 2018; 32(2): 312-326.
Vinatier C, Domínguez E, Guicheux J, et al. Role of the Inflammation-Autophagy-Senescence Integrative Network in Osteoarthritis. Front Physiol. 2018; 9: 706.
Feng L, Feng C, Wang CX, et al. Circulating microRNA let‑7e is decreased in knee osteoarthritis, accompanied by elevated apoptosis and reduced autophagy. Int J Mol Med. 2020; 45(5): 1464-1476.
Bao J, Chen Z, Xu L, et al. Rapamycin protects chondrocytes against IL-18-induced apoptosis and ameliorates rat osteoarthritis. Aging (Albany NY). 2020; 12(6): 5152-5167.
Lan H, Hong W, Qian D, et al. Quercetin modulates the gut microbiota as well as the metabolome in a rat model of osteoarthritis. Bioengineered. 2021; 12(1): 6240-6250.
Basu A, Schell J, Scofield RH. Dietary fruits and arthritis. Food Funct. 2018; 9(1): 70-77.
Feng K, Chen Z, Pengcheng L, et al. Quercetin attenuates oxidative stress-induced apoptosis via SIRT1/AMPK-mediated inhibition of ER stress in rat chondrocytes and prevents the progression of osteoarthritis in a rat model. J Cell Physiol. 2019; 234(10): 18192-18205.
Li W, Wang Y, Tang Y, et al. Quercetin Alleviates Osteoarthritis Progression in Rats by Suppressing Inflammation and Apoptosis via Inhibition of IRAK1/NLRP3 Signaling. J Inflamm Res. 2021; 14: 3393-3403.
Chen Z, Wu G, Zheng R. A Systematic Pharmacology and In Vitro Study to Identify the Role of the Active Compounds of Achyranthes bidentata in the Treatment of Osteoarthritis. Med Sci Monit. 2020; 26: e925545.
Lv S, Wang X, Jin S, et al. Quercetin mediates TSC2-RHEB-mTOR pathway to regulate chondrocytes autophagy in knee osteoarthritis. Gene. 2022; 820: 146209.
Luo P, Gao F, Niu D, et al. The Role of Autophagy in Chondrocyte Metabolism and Osteoarthritis: A Comprehensive Research Review. Biomed Res Int. 2019; 2019: 5171602.
Caramés B, Olmer M, Kiosses WB, et al. The relationship of autophagy defects to cartilage damage during joint aging in a mouse model. Arthritis Rheumatol. 2015; 67(6): 1568-1576.
Liu-Bryan R. Inflammation and intracellular metabolism: new targets in OA. Osteoarthritis Cartilage. 2015; 23(11): 1835-1842.
Zhang Y, Vasheghani F, Li YH, et al. Cartilage-specific deletion of mTOR upregulates autophagy and protects mice from osteoarthritis. Ann Rheum Dis. 2015; 74(7): 1432-1440.
Zhao X, Li Y, Lin X, et al. Ozone induces autophagy in rat chondrocytes stimulated with IL-1β through the AMPK/mTOR signaling pathway. J Pain Res. 2018; 11: 3003-3017.
Ansari MY, Ahmad N, Haqqi TM. Butein Activates Autophagy Through AMPK/TSC2/ULK1/mTOR Pathway to Inhibit IL-6 Expression in IL-1β Stimulated Human Chondrocytes. Cell Physiol Biochem. 2018; 49(3): 932-946.
Wu J, Qian Y, Chen C, et al. Hesperetin Exhibits Anti-Inflammatory Effects on Chondrocytes via the AMPK Pathway to Attenuate Anterior Cruciate Ligament Transection-Induced Osteoarthritis. Front Pharmacol. 2021; 12: 735087.
Rahmati M, Nalesso G, Mobasheri A, et al. Aging and osteoarthritis: Central role of the extracellular matrix. Ageing Res Rev. 2017; 40: 20-30.
Qiu L, Luo Y, Chen X. Quercetin attenuates mitochondrial dysfunction and biogenesis via upregulated AMPK/SIRT1 signaling pathway in OA rats. Biomed Pharmacother. 2018; 103: 1585-1591.
Zheng W, Xie W, Yin D, et al. ATG5 and ATG7 induced autophagy interplays with UPR via PERK signaling. Cell Commun Signal. 2019; 17(1):4 2.
Zhang G, Cao J, Yang E, et al. Curcumin improves age-related and surgically induced osteoarthritis by promoting autophagy in mice. Biosci Rep. 2018; 38(4): BSR20171691.
Wei B, Zhang Y, Tang L, et al. Protective effects of quercetin against inflammation and oxidative stress in a rabbit model of knee osteoarthritis. Drug Dev Res. 2019; 80(3): 360-367.
Wang J, Wang X, Cao Y, et al. Therapeutic potential of hyaluronic acid/chitosan nanoparticles for the delivery of curcuminoid in knee osteoarthritis and an in vitro evaluation in chondrocytes. Int J Mol Med. 2018; 42(5): 2604-2614.
Paul AK, Jahan R, Paul A, et al. The Role of Medicinal and Aromatic Plants against Obesity and Arthritis: A Review. Nutrients. 2022; 14(5): 985.
Zhou PH, Qiu B, Deng RH, et al. Chondroprotective Effects of Hyaluronic Acid-Chitosan Nanoparticles Containing Plasmid DNA Encoding Cytokine Response Modifier A in a Rat Knee Osteoarthritis Model. Cell Physiol Biochem. 2018; 47(3): 1207-1216.
Nirmal P, Koppikar S, Bhondave P, et al. Influence of six medicinal herbs on collagenase-induced osteoarthritis in rats. Am J Chin Med. 2013; 41(6): 1407-1425.
Tu W, Wang H, Li S, et al. The Anti-Inflammatory and Anti-Oxidant Mechanisms of the Keap1/Nrf2/ARE Signaling Pathway in Chronic Diseases. Aging Dis. 2019; 10(3): 637-651.
Marks PH, Donaldson ML. Inflammatory cytokine profiles associated with chondral damage in the anterior cruciate ligament-deficient knee. Arthroscopy. 2005; 21(11): 1342-1347.
Wang DR, Sato M, Sato T, et al. Regulation of matrix metallo-proteinase expression by extracellular matrix components in cultured hepatic stellate cells. Comp Hepatol. 2004; 3 Suppl 1(Suppl 1): S20.
Provenzano PP, Inman DR, Eliceiri KW, et al. Matrix density-induced mechanoregulation of breast cell phenotype, signaling and gene expression through a FAK-ERK linkage. Oncogene. 2009; 28(49): 4326-4343.
Dörr S, Lechtenböhmer N, Rau R, et al. Association of a specific haplotype across the genes MMP1 and MMP3 with radiographic joint destruction in rheumatoid arthritis. Arthritis Res Ther. 2004; 6(3): R199-R207.
Tan KO, Fu NY, Sukumaran SK, et al. MAP-1 is a mitochondrial effector of Bax. Proc Natl Acad Sci U S A. 2005; 102(41): 14623-14628.
Fan D, Fan TJ. Clonidine Induces Apoptosis of Human Corneal Epithelial Cells through Death Receptors-Mediated, Mitochondria-Dependent Signaling Pathway. Toxicol Sci. 2017; 156(1): 252-260.
Velasquez MT, Katz JD. Osteoarthritis: another component of metabolic syndrome?. Metab Syndr Relat Disord. 2010; 8(4): 295-305.
Fu L, Huang L, Cao C, et al. Inhibition of AMP-activated protein kinase alleviates focal cerebral ischemia injury in mice: Interference with mTOR and autophagy. Brain Res. 2016; 1650: 103-111.
Shen P, Hou S, Zhu M, et al. Cortical spreading depression preconditioning mediates neuroprotection against ischemic stroke by inducing AMP-activated protein kinase-dependent autophagy in a rat cerebral ischemic/reperfusion injury model. J Neurochem. 2017; 140(5): 799-813.
Zhang Y, Miao JM. Ginkgolide K promotes astrocyte proliferation and migration after oxygen-glucose deprivation via inducing protective autophagy through the AMPK/mTOR/ULK1 signaling pathway. Eur J Pharmacol. 2018; 832: 96-103.
Kim J, Kundu M, Viollet B, et al. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat Cell Biol. 2011; 13(2): 132-141.
Zhou S, Lu W, Chen L, et al. AMPK deficiency in chondrocytes accelerated the progression of instability-induced and ageing-associated osteoarthritis in adult mice. Sci Rep. 2017; 7: 43245.
Li J, Zhang B, Liu WX, et al. Metformin limits osteoarthritis development and progression through activation of AMPK signalling [published correction appears in Ann Rheum Dis. 2020 Sep;79(9): e119]. Ann Rheum Dis. 2020; 79(5): 635-645.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Quercetin activates autophagy suppresses apoptosis, inflammation and cartilage matrix degradation in LPS-induced chondrocytes through targeting AMPK/mTOR/ULK1 signaling pathway

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Reagents

Methods

Cartilage explant and chondrocyte isolation

Toluidine blue staining

Optimal intervention concentration of LPS and QUE screened by CCK‑8

Experimental grouping and intervention

Quantitative real-time polymerase chain reaction (qRT-PCR)

Western blotting

Immunofluorescence staining

Transmission electron microscope (TEM)

Flow cytometry

ELISA for detecting IL‑1β and TNF‑α

Statistical analysis

Results

Extraction and identification of articular chondrocytes in humans

Effects of LPS and QUE on chondrocyte viability

Effects of quercetin on the expressions of autophagy-related genes in LPS-induced chondrocytes

QUE reversed apoptosis, inflammation and cartilage matrix degradation in LPS-induced chondrocytes by autophagy-based

Expression levels of associated proteins by targeting AMPK/mTOR/ULK1 signaling pathway via QUE

QUE regulates autophagy of LPS-induced chondrocytes through targeting AMPK/mTOR/ULK1 signaling pathway

The effect of QUE activated autophagy on cell apoptosis and proliferation in LPS-induced chondrocytes through targeting AMPK/mTOR/ULK1 signaling pathway

The effect of QUE activated autophagy on inflammation and cartilage matrix degradation in LPS-induced chondrocytes through targeting AMPK/mTOR/ULK1 signaling pathway

Discussion

Conclusions

Declarations

References

Additional Declarations

Status:

Version 1