having received bone marrow or organ transplantation, or having acquired immunodeficiency syndrome were the exclusive criteria for this study. All the research protocol of the present study was approved by the Human Ethics Committee with all the patients who participated in this study having signed the informed consent before the beginning of the experiment.
Evaluation of GAS5 in cisplatin-induced AKI
Serum samples were obtained by centrifuging the blood samples from the subjects at 5000g, 4℃ for 3 min. After centrifuging, the serum were administrated with the miRNeasy Mini kit (QIAGEN, Germany) to get the total RNA of individual patients respectively with the correlated cDNA further synthetized exerting RT2 PreAMP cDNA Synthesis Kit(QIAGEN, Germany). Furthermore, RT2 SYBR® Green qPCR Master Mix (QIAGEN, Germany), StepOnePlus thermo-cycler (Applied Biosystems) and 2−ΔΔCtin method were exerted to perform the qRT-PCR aiming to evaluation the fluctuation of GAS5’s expression levels. The association of GAS5 and Creatinine clearance rate (CCr) were also revealed by Pearson's correlation coefficient by SPSS 19.0 (SPSS, Chicago, IL), aiming to investigate the potential pernicious effects in this pathological disease.
Lentiviral vector construction and infection
The LV10-CMV-RFP-Puro vector (GenePharma, Shanghai, China) was administrated with si-GAS, a short-hairpin RNA directed against GAS5, while the negative sequence was exerted for negative controlling. After receiving the lentiviral expression vectors, the 293T cells were further subjected to virus particles incubated by Polybrene (Sigma, St. Louis, Missouri, USA) and an exclusion procedure of puromycin. Besides, the GAS5 cDNA was multiplied with PfuUltra II Fusion H DNA Polymerase (Stratagene, Agilent Technologies, Santa Clara, CA, USA), followed by the subcloning to EcoRI and HindIII of pcDNA3.1 vector (Invitrogen, USA) to construct pcDNA-GAS5. The mimics and inhibitors of miR-205-5p and NC mentioned were provided by GenePharma (Shanghai, China), while Lipofectamine 2000 (Life Technologies Corporation, Carlsbad, CA) were exerted to transfect the cells. The sequences for GAS5 siRNA were 5′‐GCGAGCGCAATGTAAGCAA‐3′ Non targeting sequence (5′-ACGUGACACGUUCGGAGAATT-3′) was used as a negative control.
miR-205-5p mimic, 5′-UCCUUCAUUCCACCGGAGUCUG-3′; miR-NC mimic, 5′-UCGCUUGGUGCAGGUCGGGAA-3′; miR-205-5p inhibitor, 5′-CAGACUCCGGUGGAAUGAAGGA-3′; miR-NC inhibitor, 5′-CAGUACUUUUGUGUAGUACAA-3′
qRT-PCR
After the total RNA was isolated from the cells, the cDNA was obtained exerting High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, CA, USA) with that of miRNAs being fabricated by TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). TaqMan Universal Master Mix II, TaqMan miRNA assays for miR-205-5p and U6, and TaqMan gene expression assays for GAS5 and GAPDH were further exerted for qRT-PCR. Expressions were calculated utilizing 2-△△Ct method. The primers utilized are:
GAS5: F:5‘-GGCAAATGAGCACTAAAG -3;R:5’- CACCCACTCCTCTATCTACA -3‘
GAPDH F:TCAACGACCCCTTCATTGACC R: CTTCCCGTTGATGACAAGCTTC
miR-205-5p forward, 5′-TCCTTCATTCCACCGGAGTCTG-3′ and reverse, 5′-GCGAGCACAGAATTAATACGAC-3′; U6 forward, 5′-ATTGGAACGATACAGAGAAGATT-3′ and reverse, 5′-GGAACGCTTCACGAATTTG-3′
Western blot
Before experiment, the HK-2 cells was plated in a 6-well plate at a rate of 2 × 106 cells/well and incubated for 24 h. Cells were lysed and 50 μg protein was isolated utilizing SDS-PAGE. The polyvinylidene fluoride membrane were exerted to receive the protein sample underwent electrophoresis and then administrated with the blockage of non-fat milk. The antibodies of GAPDH (ab9485, 1:5000, Abcam) and cleaved Caspase-3 (ab49822, 1:1500, Abcam) were further exerted to administrate the foregoing membranes, followed by incubation of Goat Anti-Rabbit IgG H&L (HRP, ab205718, 1:3000, Abcam) or Goat Anti-Mouse IgG H&L (HRP, ab6789, 1:3000, Abcam), with the relevant protein levels eventually revealed by enhanced chemiluminescence reagents (Pierce, Rockford, IL, USA).
Luciferase reporter analysis
The GAS5-wt (embodying the specific sequence able to bind with miR-205-5p) and GAS5-mut (embodying the mutation of foregoing sequence) were obtained from Genescript (Nanjing, China). The luciferase analysis was performed by the dual-luciferase reporter analysis system (Promega, USA) after the HEK 293T cells’ being co-transfected with miR-205-5p or miR-NC and GAS5-wt or GAS5-mut. According to the manufacturer’s protocol, a dual-luciferase reporter assay system (Promega, USA) was used to detect the luciferase activity after co-transfection in HEK 293T cells for 48 h.
Pull-down analysis
The HK2 cells underwent a transfection of biotinylated probe (Sangon, Shanghai, China) targeting GAS5 and miR-205-5p, and 48h later, the HK2 cells were lysed, the products of which received the incubation of Dynabeads M-280 Streptavidin (Invitrogen, Carlsbad, CA, USA). The qRT-PCR was exerted for analyzing the bound RNAs.
RNA Immunoprecipitation (RIP) analysis
The Magna RIP RNA-Binding Protein IP Kit (Millipore, Bedford, MA, USA) andAgo2 antibody (2897, Cell Signaling, Danvers, MA, USA) were exerted for RIP analysis, by which the expression levels of GAS5 and miR-205-5p were consequently revealed.
HK-2 model culture
Antibiotics (100 U/ml penicillin G + 100 μg/ml streptomycin + 0.25 μg/ml amphotericin B, Invitrogen) and Dulbecco’s Modified Eagle Media/F12 with 10% fetal bovine serum (Invitrogen, Carlsbad, CA) at 37°C in a 100% humidified atmosphere of 5% CO2-95% air were exerted for culturing the HK-2 cells (American Type Culture Collection, Manassas, VA). The foregoing cells’ conservation of original phenotypic and metabolic characteristics of the proximal tubule during the culturing procedure were confirmed.
Apoptosis analysis
According to the manufacturer’s, the cells were transfected for 48h and further stained for 15min in the dark at room temperature with Annexin V and PI (Annexin V-FITC Apoptosis Detection Kit, eBioscience), the HK-2 cells’ apoptosis status were evaluated by BD FACSCalibur flow cytometer (BD Biosciences, California, USA) and Cell Quest software (BD Biosciences). After all the cells being classified as alive, early-apoptotic, late-apoptotic and dead, the apoptosis status was consequently revealed by the early-apoptotic ratio. All the above analysis was repeated triplicately.
Statistical Analysis
The data were administrated with one-way ANOVA and Dunnett’s multiple comparison tests or paired t test (version 5.00; Graph Pad Prism Software Inc., San Diego, CA). P<0.05 was selected for representing statistical significance.