Animals
Neonatal (within 3-day post born) and adult C57BL/6 mice (8 to 10 weeks old) were provided by the animal center at the Second Affiliated Hospital of Harbin Medical University. Use of animals was approved by the Ethic Committees of Harbin Medical University and conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996).
Neonatal cardiomyocytes preparation
Neonatal cardiomyocytes were isolated from 3-day-old mice in accordance with the following procedures. Briefly, after dissection, hearts were washed and minced in 0.25% trypsin. Pooled cell suspensions were centrifuged and resuspended in Dulbecco's modified Eagle's medium (DMEM Hyclone, USA) supplemented with 10% fetal bovine serum, 100 U/ml penicillin and 100 μg/ml streptomycin. The suspension was incubated in culture flasks for 90 min, which makes fibroblasts preferentially adhere to the bottom of the culture flasks. Neonatal cardiomyocytes were removed from the culture flasks and the medium was changed. Cell cultures were incubated for 48 h at 37 °C in a humidified atmosphere of 95% oxygen and 5% carbon dioxide before any experimentation.
Generation of cardiac myocyte-specific lncDACH1 overexpressing mice
Cardiomyocyte-specific lncDACH1 overexpressing mice driven by murine αMHC promoter on a C57BL/6 background was generated by Biocytogen Co., Ltd (Beijing, China) as demonstrated in previous study13.
Generation of cardiomyocyte-specific lncDACH1 knockout mice
LncDACH1 conditional KO mice (lncDACH1 Flox/Flox) was generated by using CRISPR/Cas9 technique on C57BL/6 background mice by Biocytogen Co., Ltd (Beijing, China) as demonstrated in previous study13.
Construction of adeno-associated virus 9 (AAV9) carrying deactivated clustered regularly interspaced short palindromic repeats associated protein 9 nuclease- synergistic activation mediator(dCas9-SAM) system to activate the transcription of dystrophin
Adeno-associated virus 9(AAV9) carrying dCas9-SAM system to activate the transcription of dystrophin was constructed as reported previously with brief modifications15. The sgRNA targeting on the promoter region of dystrophin was designed and cloned into the multiple cloning site of plasmid GV639 (EFS-NLS-dSaCas9-NLS-VP64-bGHpA-U6). The constructed plasmid was packaged into AAV9 virus. The sequence of sgRNA is: 5’- CGCTTCCGCGGCCCGTTCAA -3’; The mock-sgRNA target sequence (5’-CGCTTCCGCGGCCCGTTCAA -3’) was used as negative control. The obtained AAV9 virus volume was administered into C57BL/6 mice via tail vein injection at 1×1011 genome containing particles (GC)/animal in 100µl.
Construction of adenovirus carrying cF-lncDACH1 and in vivo gene delivery
Adenovirus vectors carrying cF-lncDACH1(OE- cF-lncDACH1) and a negative control (NC) and a CAG promoter conjugated with green fluorescent protein (GFP) were constructed by Genechem Co., Ltd. (Shanghai, China). OE- cF-lncDACH1, control constructs at 1×109 genome containing particles (GC)/animal in 100µl volume was administered into C57BL/6 mice with body weights ranging from 18~22g via tail vein injection. Seventy-two hours after injection, the mice were subjected to further study.
Construction of adenovirus carrying lncDACH1, lncDACH1 siRNA, conserved fragment of human lncDACH1 and infection
Adenovirus vectors carrying lncDACH1(OE-lncDACH1), a short RNA fragment for silencing lncDACH1 (Si-lncDACH1) or conserved fragment of human lncDACH1(hcF-lncDACH1) and a CAG promoter conjugated with green fluorescent protein (GFP) were constructed by Genechem Co., Ltd. (Shanghai, China). Neonatal cardiomyocytes were infected with adenovirus for 48 hours, and then subjected to subsequent study.
Transfection of Hadhb, Eif4a1, and Anp32 siRNA.
siRNA for Hadhb (siHadhb), Eif4a1(siEif4a1), Anp32(siAnp32) and a scrambled negative control RNA (siNC) were synthesized by Generalbiol (Chuzhou, Anhui, China). These siRNAs were transfected at a final concentration of 100 nM into NMVMs using the X-treme GENE Transfection Reagent (Roche, Indianapolis, USA) according to the manufacturer’s protocols. The cardiomyocytes were collected for total RNA isolation or protein purification. The sequences are: siHadhb, sense 5’- GCUCUCAGAUCUUCUAUAATT-3’ and antisense 5’- UUAUAGAAGAUCUGAGAGCTT-3’; siEif4a1, sense 5’- GCUCACCGAGAAGAUGCAUTT-3’ and antisense 5’- UUAUAGAAGAUCUGAGAGCTT-3’; siAnp32, sense 5’- GCCUCACCUCCAUUUCCAATT-3’ and antisense 5’- UUGGAAAUGGAGGUGAGGCTT-3’.
Induction of ventricular arrhythmia
C57BL/6 mice were anesthetized with 2,2,2-tribromoethanol (200 mg/kg, i.p.). An octapolar electrophysiological catheter (1.1F, SciSense Inc., Canada) was inserted into the right ventricle via the jugular vein. Intracardiac pacing was performed using an automated stimulator interfaced with the data acquisition system (GY6000; HeNan HuaNan Medical Science & Technology Ltd., Zhengzhou, China). The surface recording electrode was fixed on LV epicardium to record pseudo-ECG. Inducibility of ventricular tachycardia (VT) was determined by applying a train of ten consecutive electrical pulses with a coupling interval of 80 ms (S1), followed by two extra stimuli (S2 and S3) at coupling intervals of 2 ms, respectively. Successful induction of VT was defined as the appearance of rapid nonsinus rhythm ventricular activations lasting for three beats or more.
Optical mapping recording
Mice were heparinized and euthanized by 2,2,2-tribromoethanol (200 mg/kg, intraperitoneal injection; Sigma, St Louis, MO, USA). The heart was isolated and langendorff perfused with Tyrode’s solution (NaCl 128.2 mM, CaCl2•2H2O 1.3 mM, KCl 4.7 mM, MgCl2•6H2O 1.85 mM, NaH2PO4•2H2O 1.19 mM, Na2CO3 20 mM, and glucose 11.1 mM; pH 7.35) at 37 °C. After 10 min of stabilization, the hearts were stained with RH237 (10 μM) for membrane voltage (Vm) mapping. The dye was excited at 710 nm using monochromatic light-emitting device. The fluorescence was filtered and recorded simultaneously with a MiCAM05 CMOS camera (SciMedia, USA) at 1ms/frame and 100x100 pixels with a spatial resolution of 0.35×0.35 mm2 per pixel. Blebbistatin (10 µM, Selleckchem, Houston, TX, USA) was used to inhibit motion artifact during optical mapping.
Experimental protocol of optical mapping
A pair of hook bipolar electrodes was inserted into apex of heart for pacing. A pseudo-ECG was obtained with widely spaced bipolar electrodes to determine ventricular rhythm. The ventricles were initially paced at a constant pacing cycle length (PCL) of 200ms. The PCLs were progressively shortened (200, 100, 60, 40, 30, 20ms) with a duration of 1-2 s until ventricular tachycardia (VT) was induced or the loss of 1:1 capture of the ventricles. Optical recording was performed after 20 beats of stable pacing at each PCL. Optical recordings were then performed during VT.
Patch-clamp recording
Whole-cell configuration of the patch-clamp technique was used to record peak INa and the inward rectifier K+ current (IK1). INa recordings were performed at room temperature (22~23°C) by using a MultiClamp 700B (Alembic Instruments) amplifier. Pipettes (tip resistance 1 to 2 MΩ) were filled with a solution containing (in mM): NaCl 5, CaCl2 2, MgCl2 2, CsCl 130, HEPES 10, EGTA 15 and MgATP 4 (pH 7.2 with CsOH). Myocytes were bathed with a solution containing (in mM): NaCl 25, CaCl2 2, MgCl2 2.5, CsCl 108.5, HEPES 10, CoCl2 2.5 and glucose 10 (pH 7.4 with CsOH). IK1 was measured as Ba2+-sensitive steady-state current and treated with 300 µmol/L Ba2+ recording at 37 C using a patch clamp amplifer (MultiClamp 700B). The external solution for recording IK1 contained (in mM): NaCl 136, KCl 5.4, NAH2PO4 0.33, MgCl2·6H2O 1, CaCl2 1.8, HEPES 5 and glucose 10 (pH 7.37 with NaOH). The pipette solution for recording IK1 contained (in mM): KCl 20, K-aspartate 110, HEPES 5, MgCl2 1, Na2ATP 5 and EGTA 10 (pH 7.20 with KOH).
Differentiation of human induced pluripotent stem cells(hiPSCs) to cardiomyocytes
Undifferentiated hiPS cells (AC-iPSC) were purchased from NC5 (Help Stem Cell Innovations, NC2001) and cultured on Matrigel-coated plates in an E8 medium (CA1001500, CELLAPY). Differentiation basal medium composed of RPMI1640 medium (C11875500BT, Thermo Fisher Scientific) and B27 minus insulin (A1895601, Thermo Fisher Scientific) was used to induce cardiomyocyte differentiation. Specifically, the 70~80% confluent hiPSCs were incubated in differentiation basal medium added with CHIR-99021 (HY-10182, MCE) for 1 day and Wnt-C59 (S7037, Selleck Chemicals) for 2 days. Then, the cells were cultured in RPMI1640 basal medium containing B27 (17504044, Thermo Fisher Scientific), which was replaced with fresh medium every 1~2 days. Beating cells were observed after 8 days of differentiation induction and used for further study.
Construction of truncated LncDACH1 fragment plasmids
The sequence of lncDACH1 was divided into five fragments. The cDNA of each fragment was inserted into the pCDNA3.1, respectively. The first 417 nts of the entire sequences was cut off and constructed as fragment-a (418-2085 nts). Another 417 nts was cut off to generate fragment-b (835-2085 nts). The third 417 nts was cut off to generate fragment-c (1251-2085 nts). Fragment-d is from 835-1668 nts, and fragment-e is from 835-1251 nts.
Isolation of cardiac myocytes
Hearts were rapidly excised, cannulated, and perfused with Ca2+ -free Tyrode solution (in mM): NaCl 137, KCl 5.4, NaH2PO4 0.16, glucose 10, CaCl2 1.8, MgCl2 0.5, HEPES 5.0, and NaHCO3 3.0 (pH 7.4 adjusted with NaOH) for 5 min. The heart was then perfused with a solution containing collagenases B and D (Roche) and protease XIV (Sigma) until digestion was complete. Tissue was dissociated using forceps, and dissociated left ventricular cardiomyocytes were gradually exposed to Ca2+ (from 50 to 500 µM over 40 min) and plated in culture chambers for further studies.
Immunocytochemistry of isolated mouse ventricular myocytes.
Cardiomyocytes were fixed for 10 min with 4% paraformaldehyde in PBS, and then washed in PBS for 10 min (2 times). The cells were permeabilized with 0.5% Tween 20 for 30 min. After washed out with PBS for 10 min (3 times), cardiomyocytes were incubated with primary antibodies against Nav1.5 (ASC005, Alomone, 1;200) and dystrophin (MANDYS8, SIGMA, 1;300) overnight at 4°C. Following washout with PBS (10 min, 3 times), cells were incubated with secondary antibodies for 1h and washed with PBS (10 min, 3 times). The cover slips were mounted onto frosted slides in a solution composed of 90% FluorSave Reagent (Calbiochem, La Jolla, CA, USA) and 10% 10X PBS.
Fluorescent in situ hybridization (FISH)
In situ hybridization was performed with a Fluorescent in Situ Hybridization (FISH) Kit (RiboBio, Guangzhou, China). Briefly, isolated cardiomyocytes were fixed in 4% formaldehyde at 4°C for 10 min and dried out on the slides at room temperature (RT). The slides were rinsed and permeabilized with 0.5% Triton-100 in PBS at RT for 30 min, washed with PBS solution, and prehybridized at 37°C for 30 min before hybridization. The prehybridized slides were then incubated with lncRNA-probe in hybridization solution at 37°C for 16 h. After hybridization, the slides were washed six times with prewarmed wash buffer and PBS solution. Finally, the slides were counterstained with DAPI and visualized using a confocal laser-scanning microscope (Zeiss 800, Germany).
Quantitative Real-time RT-PCR
Total RNA was extracted by using Trizol reagent (Invitrogen, USA) according to manufacturer’s protocol. Total RNA (0.5μg) was reverse transcribed by using the TransScript reverse transcriptase (GMO technology, Beijing) to obtain cDNA. The RNA levels were determined using SYBR Green I incorporation method on ABI 7500 fast Real Time PCR system (Applied Biosystems, USA), The expression levels of mRNA were calculated using the comparative cycle threshold (Ct) method (2−ΔΔCt). Each data point was then normalized to ACTIN as an internal control in each sample. The final results are expressed as fold changes by normalizing the data to the values from control subjects. The primers are: Mus lncDACH1 Forward: 5’-AAGATAGGATGTTGGGGCAG-3’ Mus lncDACH1 Reverse: 5’-ACCATAGCACAAACACTTCC-3’ Mus Dystrophin Forward:
5’- CGGGTTGGCTTTGAATGCTC -3’; Mus Dystrophin Reverse:
5’- AGTCTTTGGGTGGCTGAGTG -3’; Mus DACH1 Forward:5’-AACCGCAAGAGACAGCATCG-3’; Mus DACH1 Reverse: 5’-GGACAGGCCATCAGGAAACAG-3’; Mus SCN5a Forward:
5’- GAAGGAACGCAGCACAGACAG-3’; Mus SCN5a Reverse:
5’- CATCGCCCTTGACCCATACTA -3’; Mus Hadhb Forward:
5’- CCAAGAAGGCACAGGATGAAG -3’; Mus Hadhb Reverse:
5’- CCAGTGAGGAAGGACGGATG -3’; Mus klhl1 Forward:
5’- CCGCTTGGTTGTTCTCATAATC-3’; Mus klhl1 Reverse: 5’-TCTGCCTCTTGCTATCATCAC-3’; Mus aurora kinase A Forward:5’-TTTAGTAATCTGGAGGGAAGGTTC-3’; Mus aurora kinase A Reverse :5’-CACACTCTGGCACTTGAAGG-3’; Mus MZT1 Forward:5’-TCGTCTGCTGGTCAGTAGTC-3’; Mus MZT1 Reverse:5’-CTTGGAAGAGATGCCTGTAATAG-3’; Mus DIS3 Forward: 5’- GCGGCTATGAATGATGATATTACC-3’; Mus DIS3 Reverse: 5’-CATGTGGAATCGGATCTCTGG-3’.
Western blot
The total, membrane and cytoplasmic protein samples were extracted from cardiac tissues of C57BL/6 mice for immunoblotting analysis. Total protein was collected with the treatment of RIPA lysis buffer (Beyotime, Beijing, China) and a protease inhibitor cocktail (Roche, Basel, Switzerland) at 4°C followed by centrifugation. Extraction of surface and cytoplasmic proteins was conducted using the Surface and Cytoplasmic Protein Reagent Kit (Cat#P0033; Beyotime, Shanghai, China) according to the manufacturer’s instructions. Protein samples were fractionated by SDS-PAGE and then transferred to PVDF membrane. The membranes were blocked in Tris-buffered saline containing 5% milk and then incubated with primary antibodies at 4°C overnight. The primary antibodies include anti-Nav1.5 (ASC005, Alomone, 1:200), anti-dystrophin (MANDYS8, SIGMA, 1:500). The anti- β-actin (1:20000 dilution, 66009-1-Ig, Proteintech), and anti-N-cadherin antibody (Cat#ab76011, 1:5000; Abcam, Cambridge, UK) were used as internal controls. Western blot bands were captured on the Odyssey Infrared Imaging System (LI-COR Biosciences, USA) and quantified with Odyssey v1.2 software by measuring the band intensity (area × OD) in each group. The band intensity was normalized to the internal control. All antibodies were diluted in PBS buffer.
RNA pulldown and immunoblotting
The RNA pull-down was performed as described in the previous study13. Briefly, Biotin-labeled, full length lncDACH1 RNA and antisense RNA were prepared with the Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase (Roche). Biotinylated RNAs were treated with RNase-free DNase I (Invitrogen) and purified on G-50 Sephadex Quick Spin columns (Roche). Biotinylated RNA (17μg) was heated to 65°C for 10 min and slowly cooled to 4°C. Then the RNA was mixed with tissue extracts in pulldown buffer supplemented with tRNA (0.1 μg/μl) and incubated at 4°C for 2 h. Washed Streptavidin agarose beads (60 μl, Invitrogen) were added to each binding reaction and further incubated at 4°C for 1 h. Beads were washed briefly five times in pulldown buffer and boiled in SDS buffer, and the retrieved protein was visualized by immunoblotting.
RNA immunoprecipitation (RIP)
RNA immunoprecipitation (RIP) experiments were performed by using a Magna RIPTM RNA-Binding Protein Immunoprecipitation Kit (Millipore, USA) as previously reported13. Briefly, heart tissue was pieced and lysed in 220 μl of lysis buffer containing protease inhibitors and RNase Inhibitor and centrifuged at 14,000 × g for 10 min. The supernatants were incubated with anti-dystrophin, anti-hadhb and anti-rabbit IgG antibody for overnight at 4°C with gentle rotation. Protein G magnetic beads (50 μl) were added and incubated at RT with gentle rotation for 3 h. RNA was extracted with 400 μl phenol:chloroform:isoamyl alcohol (125:24:1, pH = 4.3) according to the manufacturer’s instructions before quantitation by RT-qPCR.
Mouse models of heart failure (HF) by transaortic constriction (TAC) and by coronary artery ligation
Mice were randomly divided into sham and TAC groups. In each group, mice were anesthetized with 2,2,2-tribromoethanol (200 mg/kg, i.p.) for TAC model. The animal was orally intubated with 20-gauge tube, and ventilated (mouse ventilator, UGO BASILE, Biological Research Apparatus, Italy) at the respiratory rate of 100 breaths/min with a tidal volume of 0.3 ml. The transverse aorta was constricted by a 6-0 silk suture ligature tied firmly against a 27-gauge needle between the carotid arteries. Then, the needle was promptly removed to yield a constriction of 0.4 mm in diameter. For sham group mice, the animals received the same procedures without aorta constriction.
Statistical analysis
Data are expressed as mean ± SEM. Statistical analysis was performed using unpaired Student’s t test or One-Way Analysis of Variance (ANOVA) followed by Tukey’s post-hoc analysis. A P< 0.05 was considered statistically different.