Ethical approval
Blood specimens were comed from voluntary donor in good health, 18 years old, with undersigned consent permitted by the ethical committee of the Zhejiang Putuo Hospital.
Separation and culture of PBMCs
Under aseptic conditions, PBMCs was isolated from 5ml of whole blood using Lymphoprep™ (Stemcell, 07801) density gradient centrifugation method in strict accordance with the manufacturer's instructions
The latest isolated PBMCs were inoculated to Complete StemSpan™ SFEM II Medium (Stemcell, 09605) with Supplement (100×) (Stemcell, 02694).
Reprogramming of PBMCs
Four days after seeding (Day 0), the cells were gathered by centrifugation (100g, 5 min) and transfected with Sendai virus in a total volume of 1 ml (Cellapy, CA5002003). Under sterile conditions,transduction was operated in complete PBMC medium containing 6 µg/ml Polybrene by centrifugation at 200g for 2h at normal room temperature. Then , particles were resuspended in the same medium including virus and placed in 24-well plates and cultured at 37°C. After 4 hours, the cell suspension was centrifuged to remove Sendai virus. Cells were resuspended in 24-well plates with fresh complete PBMC medium for 2 days. On day 3, cells were gathered by centrifugation, resuspended and plated on Matrigel-coated 6-well plates (Corning, 354277). The medium was renewed every other day. On day 7, transitioning into iPSC medium began by replacing half of the StemSpan™ SFEM II Medium with ReproTeSR™ Medium (Stemcell, 05926). From day 8 on, the entire volume of medium was replaced with ReproTeSR™ Medium. The medium was changed daily thereafter and the appearance of iPSC colonies was observed. On days 15 to 21 post-transduction, colonies are ready for transfer. Colonies were smoothly obtained and transferred to Matrigel-coated 12-well plates for augmentation.
Residual detection of exogenous factors
According to the Reprogramming Kit, the following PCR primer sets were used to detect transgenes in reprogrammed cells.
Target
|
Primer sets
|
Product size
|
KOS
|
Forward: ATGCACCGCTACGACGTGGC
Reverse: ACCTTGACAATCCTGATGTGG
|
528bp
|
Klf4
|
Forward: TTCCTGCATGCCAGAGGAGCCC
Reverse: AATGTATCGAAGGTGCTCAA
|
410bp
|
c-Myc
|
Forward: TAACTGACTAGCAGGCTTGTCG
Reverse: TCCACATACAGTCCTGGATGATGATG
|
532bp
|
Alkaline phosphatase (AP) staining
After 3 passages, cells were stained for AP strictly following the manufacturer's protocol, and pluripotency was detected using the AP detection kit (Stemgent, 00-0055). Place cells in Fix Solution and fix for 2-5 minutes at normal room temperature. Cells were then placed in latest equipped AP Substrate Solution and incubated in the dark for 10-20 minutes. Typical iPSC colonies stain positive for alkaline phosphatase in red or purple.
Evaluation of differentiation ability of three layers in vitro
To evaluate the capability of hiPSCs to differentiate into the three germ layers, in vitro differentiation was operated using the STEMdiff Trilineage Differentiation Kit (Stemcell, 05230) strictly following the instructions.
Immunofluorescence (IF) staining
Expression of pluripotency markers was investigated with IF staining. Cells were observed under an inverted fluorescence microscope (OLYMPUS 1x71). hiPSCs were characterized with Oct-4, Nanog, Sox2 and TRA-1-60 antibodies.
Karyotyping
Cells were fixed and analyzed by standard G-banding analysis. Karyotyping was performed by IxCell biotechnology Co.,Ltd.