Cell culture and treatment
As described previously(Meng et al., 2019), mice 24-hours-old C57BL/6J were used to isolate and purify primary microglial cells. The cortical neurons were isolated from C57BL/6J mice embryos at the E15-17 stage(Zhang et al., 2020). Here won’t describe in detail. The microglial cells were acquired and replaced onto the indicated plates with new complete medium, and primary neurons were cultured in medium containing B27 (Life Technologies, B27 supplement 50X, 17504) and glutamine (Gibco, GlutaMAXTM 200Mm (100x), 35050061).
Dauricine was purchased from MUST (ChengDu, China, A0315), dissolved in DMSO for mother liquor, and diluted with medium when treating cells. Limitation of drug administration capacity in mice studies(Li and Gong, 2007) (Yang et al., 2010), dauricine finally presented as a turbid liquid in 0.9% NaCl saline. The dosage was 10 mg.kg-1 and the volume of administration was 10 mL/kg for intragastric administration. One dose at the first reperfusion of fecal cerebral ischemia within 30 mins, one dose per day. An experiment was conducted on primary microglia cells, in which dauricine or vehicle were pre-treated for 1h, followed by LPS (200ng/mL) to stimulate inflammation, and collected the cell samples for next detection.
Oxygen-glucose deprivation-reperfusion
Oxygen-glucose deprivation-reperfusion (OGD-R) models of primary cortical neurons are a well-accepted model of cerebral ischaemia reperfusion in vitro(Guo et al., 2018). Briefly, the culture mediums for neurons were substituted with NeurobasalTM-A medium (1X) liquid that contained no glucose, and the gas mixture composed of 95% N2 and 5% CO2 was substituted for the gas with 5% CO2 for 15 mins through a hypoxia chamber (Billups-Rothenberg, USA). Chamber was sealed and incubated at 37 °C for 10 mins, then culture mediums were substituted to normal medium with glucose and dauricine or DMSO, and incubated in 37 °C with 5% CO2 for 3 h.
Cell viability assays
The viability of neurons was detected by the CCK-8 (Dojindo Laboratories, CK04) andcytotoxicity detection kit (LDH) (Roche, 11644793001). Post-treatment of OGD and drug for 1h, then underwent OGD-R for 3h, next 50 μ L cell supernatant was taken each well of 96-well plates and added 50 μ L LDH working mixture away from light, and the cell was added new medium with CCK-8 at 37 °C for 1-4 h. Respectively, the absorbance at 450 nm (CCK-8) and 490 nm (LDH) was measured by a microplate reader. The result of cell viability was presented as the percentage of living cells to control cells.
Calcein acetoxymethylester/propidium iodide AM/PI staining assay
Calcein - AM/PI Double Stain Kit (Dojindo Laboratories, C542) was used to detect the viability of neurons. Primary cortical neuron was treated with OGD-R, and then incubated with the calcein-AM and PI buffer in 37 °C with 5% CO2 for 15 minutes away from light, next captured with a fluorescence microscope (OLYMPUS, IX73P1F). The viable cells with green fluorescence, and dying cells with red fluorescence, so the viability of neurons was counted with the ratio of green fluorescence to green fluorescence and red fluorescence.
Middle cerebral artery occlusion in mice
The experimental animal ethics review protocol for Drum Tower Hospital at Nanjing University has been approved, the Experimental Animal Ethics Committee has examined the protocol, and the studies were conducted according to the guidelines set by Nanjing University's Guide for Animal Care and Use Committee. All mice experiments were conducted with C57BL/6J (B6) mice (eight weeks old; 20 to 24 g body weight) obtained from Nanjing University's Animal Model Centre. Under anesthetizing with isoflurane, the middle cerebral artery was blocked with 6-0 surgical monofilament nylon sutures (Doccol Corporation, USA), and caused the decrease of the blood flow to below 20%(Egashira et al., 2013; Zhang et al., 2020). The blood flow was restored in the middle cerebral artery (MCA) region followed occlusion for 1h. In the sham control mice, the same operation was applied instead of insertion of the 6-0 surgical monofilament nylon sutures into the MCA.
Infarct volume calculation
The mice were euthanized at day 7 after focal cerebral ischemia, and the infarct volume of brain tissue was measured. After cutting the brains coronally into six seria1 1-mm slices, then immersed in 2% TTC (2,3,5-triphenyltetrazolium chloride, Sigma, T8877) for 20 mins(Wu et al., 2019). ImageJ (the National Institutes of Health, version 1.8.0_172) was used to analyze the images with TTC, and the infarct volume is expressed with the formula for calculating : Percentage lesion volume (%) = (left hemisphere volume - right un-infarcted volume) / (left hemisphere volume x 2) x 100% (Cen et al., 2013).
Neurological deficit scoring
Neurological function of mice was evaluated until day 7 after MCAO(Meng et al., 2021), including rotarod test, forelimb grip strength test, and the modified neurological severity score (mNSS) test. Grip strength meter (BIOSEB, USA) was used to measure the forelimb grip strength. In triplicate, the strength of the grip was recorded before release, and the average was recorded at the previous day, day 1, 3 and 7 after MCAO(Alamri et al., 2018). The Rotarod Test (IITC Life Science, USA) was applied to assess motor deficits and sensorimotor coordination, and measurements were taken on the previous day, on day 1, 3 and 7 after MCAO(Zhang et al., 2011). The mNSS test measures sensory function, motor function, reflexes, and balance, and was administered on day 1, 3 and 7 after MCAO(Chen et al., 2001). During the rating of mice, the investigator was blinded to the experimental groups.
Cerebral blood flow measure
Utilizing the PeriFlux System 5000 (Perimed AB, Sweden), the cerebral blood flow is strictly monitored during MCAO modeling, and verification of model success and injure was measured the cerebral flood flow by PeriCam PSI (Perimed AB, Sweden) at post-operation.
RNA isolation and quantitative real-time PCR
Tissue and cell samples were lysed and extracted with RNA Isolation Kit (FastPure Cell/Tissue Total RNA Isolation Kit V2, Vazyme, RC112). Quantitative real-time PCR was performed in a Roche LightCycler ® 96 system (Roche, Germany) with a SYBR green kit (Accurate, China, AG11701). The primers are as follows:
TNF-α: forward primer- CCTGTAGCCCACGTCGTAG; reverse primer- GGGAGTAGACAAGGTACAACCC;
IL-1β: forward primer- GAAATGCCACCTTTTGACAGTG; reverse primer- TGGATGCTCTCATCAGGACAG;
IL-6: forward primer- TAGTCCTTCCTACCCCAATTTCC; reverse primer- TTGGTCCTTAGCCACTCCTTC;
GAPDH: forward primer- AGGTCGGTGTGAACGGATTTG, reverse primer-TGTAGACCATGTAGTTGAGGTCA;
β-Actin: forward primer- GGCTGTATTCCCCTCCATCG, reverse primer- CCAGTTGGTAACAATGCCATGT.
RNA Sequence
The sequence was performed by Majorbio (Shanghai, China), based on Illumina Novaseq 6000 Sequencing platform. The percentage of Q30 base was above 95.73%, and the clean data of each sample was above 6.35 Gb. Based on the quantitative results of expression levels, the differential genes between groups were analyzed, including differential Venn analysis, Reactome enrichment analysis, functional enrichment analysis, cluster analysis, and KEGG enrichment analysis.
Cytokine analyses in cellular supernatant
Wayen Biotechnologies (Shanghai, China) performed the Luminex liquid suspension chip, and monitored the concentration of cytokine in cellular supernatant with the Bio-Plex Mouse Panel 23-plex Cytokine kit(Wei et al., 2021). In brief, 50 μL samples or standard substance were added into 96-well plates, and incubated for 30 mins in room temperature and away from light, then added 25 μL diluted detection antibody and incubated for 30 mins as before, next added 50 μL diluted streptavidin-PE and incubated for 10 mins. Finally, the signal was measured by Bio-Plex 200 System (Luminex Corporation, Austin, TX, USA).
Western blot assay
RIPA lysis buffer (Thermo Scientific, USA, 89901) was used to extract the total proteins. In brief, 10% SDS-PAGE was adopt to separate the protein and the protein was electrophoretically transferred onto 0.2 μm PVDF membranes (Immobilon-PSQ Transfer membrane, Merck Millipore, ISEQ00010), and 5% skim milk were applied to block the membranes for 2 h at room temperature, then incubated at 4°C as least 12 h with the antibodies: anti-Stat5 antibody (CST, 9363S, 1:1000), anti-phospho-Stat5 antibody (CST, 4322S, 1:1000), anti-P-NF-kB antibody (CST, 3033S, 1:1000), anti-NF-kB antibody (CST, 8242S, 1:1000), anti-β-tubulin antibody (Bioworld Technology, AP0064, 1:2000). Corresponding secondary antibodies were chosen to combine the membranes for 1 hour at room temperature and were visualized with the Chemiluminescent HRP Substrate (Millipore, USA, WBKLS0500), ImageJ (the National Institutes of Health, version 1.8.0_172) was used to quantify the bands with gray value. The relative protein expression was expressed with the band intensity to the β-tubulin.
Immunofluorescence staining in microglia cells
Microglia cell was treated with lipopolysaccharide or dauricine for 3 h, then discarded the supernatant and fixed in 4% paraformaldehyde for 15 mins, 0.25% Triton X-100 was used to permeabilize for 15 mins, then 2% bovine serum albumin was applied to block for 2h, followed by incubating with indicated anti-Iba1 antibody (Abcam, ab5076, 1:100) at 4°C for at least 12 h. Next day, antibody was recycled and cells was gently washed 3 times by PBS, and then corresponding secondary antibodies with 594 nm wavelength (Invitrogen, 1:500) was incubated for 2 h, avoiding light, at room temperature. DAPI staining kit (Bio-world, BD5010, 1:1000) was used to counterstain the nuclei. Fluorescence microscope (OLYMPUS, IX73P1F) was applied to obtain the images, and positive amount was quantified with ImageJ (the National Institutes of Health, version 1.8.0_172).
Ligand–receptor docking and analysis
AutoDock 4 program (version 4.2.6) was adopted to perform the Ligand–receptor docking. The binding site was analyzed, and images were generated with PyMOL, version 2.2.0(Seeliger and de Groot, 2010). The STAT5a and STAT5b 3D protein structure are from PDB (Protein Data Bank, www.rcsb.org). The dauricine 3D structure is from PubChem (pubchem.ncbi.nlm.nih.gov).
Statistical analysis
All values are expressed with the mean ± SEM, and Student’s two-tailed t test was used for two-group comparisons and one-way ANOVA followed by Dunnett’s test for multiple pairwise comparisons was used to analyze the quantitative variables. Statistically significant was defined with P<0.05. GraphPad Prism 8 (GraphPad Software, USA, version 8.0.2) was performed the statistical graph.