Established SETD4 knockout mouse on the Cyagen platform
Customized SETD4 gene (NCBI ID, 224440) conventional knockout C57BL/6 mice were provided by the Cyagen Biosciences Inc. (Suzhou, China). We used CRISPR/Cas9 technology to edit mouse SETD4 gene. And exons 6–8 of SETD4 gene were selected as targets. Designed sgRNAs and Cas9 mRNA vectors were electrotransfected into the fertilized egg; embryo was transferred after in vitro fertilization to obtain SETD4 knockout mice. Genotyping was performed as conditional PCR methods using mouse tail genomic DNA and further identified by DNA sequencing. The primers for genotyping were as follows: forward (F): GTTGGAGAGGAGTAAAGAGCCG; reverser 1(R1): TGAAGAGTCCCACAGGCTCAAC; reverser 2(R2): TGCAGAGGAGATCCCAGTATC. SPF-level heterozygous mice were bred at the Experimental Animal Center of Guangdong Medical University, and the qualified mice were divided into homozygous (SETD4-/-, KO), heterozygous (SETD4+/-) and wild type (SETD4+/+, WT) groups. The diagram of the SETD4 gene knockout is shown in Fig. 1a.
Isolation, culture and identification of BMSCs from WT and SETD4 KO mice
BMSCs were isolated, cultured and identified as per published protocols [14, 15]. Briefly, after anesthesia with Avertin, the mice (male, weighting » 20 g) were sacrificed by cervical dislocation. Isolated femur and tibia were grinded and crushed, and the cells were suspended with cold DMEM medium (HyClone) and filtered with 70-μm filters, then cell masses were treated with red blood lysing buffer (#R7757, Sigma) for 5 min at room temperature. After washing with cold DMEM medium twice, cells were suspended with mouse BMSC-specific medium (#MUBMX-90011, Cyagen Biosciences Inc.) and plated in an incubator at 37°C with saturated humidity. For normoxic culture, cells were conventionally maintained (21% O2, 5% CO2); for hypoxic culture, cells were maintained in a hypoxic incubator (Galaxy 48R, Eppendorf, Germany) at 2% O2, 5% CO2 and 93% N2. Cells in the third passage (P3) were subjected to flow cytometrical analysis of its immunophenotype (CD34, CD45R, CD73 and CD90), and cells in P5-P6 were subjected to associated experiments.
Induced differentiation of BMSCs
We used Transforming growth factor b1 (TGF-b1) plus 5-Aza-2’-deoxycytidine (5-Aza) to induce myogenic differentiation[12]. For myogenic differentiation, 1×105 cells were seeded on 6-well plates, and then cells were treated with combination of TGF-b1 (5 ng/mL, #100-21, PeproTech, USA) plus 5-Aza (5 μmol/L, #11390, Sigma-Aldrich, Germany) for 24 h under normoxic condition (21% O2), then medium was changed for DMEM supplemented with 10% FBS (Gibco), TGF-b1 for continuous 14 days. The cells were subjected to RNA isolation and quantitative RT-PCR analysis of the expression of differentiation-related markers of cardiomyocyte lineage as following: Nkx2.5, Gata4, Mef2a, ANP, CX43 and cTnT.
Cell viability assessment by CCK-8 assay
CCK-8 assay was used to test the cell viability as previously described [16]. Briefly, BMSCs (2×103 cells/well in 200 μL medium) were seeded onto 96-well plates. Cells were allowed to recover overnight; the medium was changed every 3 days. At 0, 1, 2, 3 and 7 d setpoints, 10 μL of CCK-8 reagents (#SPDA-D010, Beyotime Institute of Biotechnology, Nanjing, China) was added, cells were maintained for additional 2 h, then OD values at 450 nm were measured using a microplate reader (Thermo Scientific, USA). Each group was duplicated in six wells.
Cell migration assay
Transwell migration assay was performed using 8-μm pore size polycarbonate membrane chambers (Corning, Tewksbury, MA, USA) as previously described [17]. Briefly, 2×104 BMSCs in total 200 μL were seeded in the upper chamber; the lower chamber contained 500 μL DMEM medium supplemented with 10% FBS. Cells were maintained for 24 h at 37°C in the incubator, and then the chambers were fixed for 15 min with 4% paraformaldehyde and stained with 0.1% crystal violet, followed by washing with PBS twice. Cells on the upper surface of the membrane were removed. The images were photographed with a microscope (Leica, Wetzlar, Germany) at 20× objective field, and the number of migrated cells on the lower surfaces of the membranes was counted. Each experimental group was repeated in three chambers, and cell numbers from a total of nine representative fields were obtained.
Assessment of angiogenic factors by ELISA
A total of 2×105 BMSCs were seeded on 6-cm dishes, and cells were maintained under normoxia (21% O2) and hypoxia condition (2% O2) for 1, 3 and 7 d. Cell culture supernatant was collected and subjected to ELISA analysis of VEGF levels, according to the manufacturer’s instructions. Mouse VEGF ELISA kit (#RRV00, R&D, USA) was used.
Tube formation assay
HUVECs (presented by Dr. Xujuan Zhang, Department of Physiology, Guangdong Medical University) were maintained with DMEM medium supplemented with 10% FBS. Cells in the logarithmic growth phase were used for experiments. A total of 300 μL Matrigel (#9056007, Corning, USA) was added in a 24-well plate and coated at 37°C for 30 min. A total of 5×104 well HUVECs were seeded per wells. After 10 min of cell attachment, the media was replaced by the WT and SETD4-KO BMSC conditional media. Images were acquired after 6 h of cell culture under a 10× microscope objective. The tube formation images were analyzed by the software Image J (https://imagej.nih.gov/ij/).
RNA isolation, reverse transcription (RT) and PCR
Cellular total RNAs were extracted using TRIZOL reagent (#15596-026, Ambion, USA) and quantitated by SimpliNano (Biochrom, Germany). Total 200 ng RNA was used to generate cDNA using an RT kit (#K1622, Fermentas, USA). Quantitative PCR was performed using a LightCycler 480 II machine (Roche, Swish). In addition, the 20 μL reactive mixture included 10 µL SYBR Green I PCR Master Mix (#QPK-201, TOYOBO, Japan), 0.4 µL forward primer (10 µM), 0.4 µL reverse primer (10 µM), 2 µL cDNA and 7.2 µL ddH2O. PCR amplification was performed as follows: 95°C for 1 min and then 45 cycles of 95°C for 5 s and 60°C for 20 s. 2-DDCT method was used to determine the levels of mRNAs. Primers (5’–3’) spanning exon-exon junction are listed as follows:
SETD4, CATGTGCAGGTAAAAGCGGC, CTCCTGGTGCTTCCTACAGC;
VEGF-A, CAAACCTCACCAAAGCCAGC, CACAGTGAACGCTCCAGGAT;
Gata4, AGCTCCATGTCCCAGACATTC, GCTGTTCCAAGAGTCCTGCT;
Nkx2.5, CACCACTCTCTGCTACCCAC, AGCGCGCACAGCTCTTTT;
Mef2a, GCAGTGCAAGTGGGATGTTG, CCCTTGCTTGATGGGGGAAT;
cTnT, TTCAGAGGGAGAGCCGAGAG, GCACCAAGTTGGGCATGAAG;
CX43, TGAAAGAGAGGTGCCCAGAC, ACACGTGAGCCAAGTACAGG;
ANP, ATCCTGTGTACAGTGCGGTG, TTCGGTACCGGAAGCTGTT;
SM22α, GGTCCATCCTACGGCATGAG, TGCTCCTGGGCTTTCTTCAT;
α-SMA, CCTTCGTGACTACTGCCGAG, AATGCCTGGGTACATGGTGG;
Gli2, AGCCTTCACCCACCTTCTTG, TCTGCTTGTTCTGGTTGGCA;
Grem2, CATTGCAGGATGTTCTGGAAGC, CTGGTGATGCCACCTCTCTG;
Map7, CAGTGGAGATCCAGACAGGC, TAACAACGCTGCTCTCCCAG;
E2f7, TGAACTCCCTGCAGCTTGAC, AGCTCGGATAGCGAGCTAGA;
Shox2, GAGGCCCGAGTACAGGTTTG, CGCCTGAACCTGAAAGGACA;
Foxo6, CTGGAAGAACTCCATTCGGCA, AGGTGCAGCTGCTTCTTCTT;
Klf14, GAGGATGAGCTCTCTGACGC, GGTACGCTGGTGTGACTTGA;
Nr2f2, GCATGAGACGGGAAGCTGTA, ACAGGTACGAGTGGCAGTTG;
Dyrk3, GGCTAAATATTACCACTGAGCCAC, CTCCAGCTTCTCGTAGGCAG;
b-actin, GTTGGAGAGGAGTAAAGAGCCG, TGAAGTGTCCCACAGGCTCAAC.
Western blot
Cells were lysed with RIPA buffer (Beyotime Institute of Biotechnology). A sample of 35 µg total proteins were subjected to 12% SDS-PAGE and then transferred to PVDF membranes (Millipore, USA). After washing with TBST twice, the membranes were incubated with 5% skim milk powder in TBST at 37°C for 1 h and then primary antibodies at 4°C overnight. The primary antibodies include SETD4 (1:500, #173906, Abcam, UK), PCNA (1:500, #2586, CST, USA), Caspase3 (1:1000, #9662, CST), Bcl2 (1:500, #12789-1-AP, Proteintech, Wuhan, China), CyclinA2 (1:1000, #18202-1-AP, ProteinTech), CyclinB1 (1:500, #55004-1-AP, ProteinTech), CyclinD1 (1:2000, #60186-1-Ig, ProteinTech), CyclinE (1:500, #11554-1-AP, ProteinTech), CDK2 (1:500, #10122-1-AP, ProteinTech), CDK4 (1:500, #11026-1-AP, ProteinTech), CDK6 (1:500, #14052-1-AP, ProteinTech), P16 (1:500, #10883-1-AP, ProteinTech), P21 (1:500, #10355-1-AP, ProteinTech), H4K20me1 (1:5000, #ab177188, Abcam), H4K20me2 (1:2000, #ab78517, Abcam), H4K20me3 (1:1000, #ab177190, Abcam), H3K4me1 (1:1000, #BS1174, Bioword, Nanjing, China), H3K4me2 (1:2000, #ab32356, Abcam), H3K4me3 (1:1000, #ab213224, Abcam), H3K27me1 (1:1000, #BS7235, Bioword), H3K27me2 (1:1000, #BS7236, Bioword), H3K27me3 (1:1000, #ab192985, Abcam), H3K36me1 (1:10,000, #ab176920, Abcam), H3K36me2 (1:5000, #ab176921, Abcam), H3K36me3 (1:1000, #BS7239, Bioword), H3K79me1 (1:10,000, #ab177183, Abcam), H3K79me2 (1:2500, #ab177184, Abcam), H3K79me3 (1:1000, #ab208189, Abcam), b-actin (1:1000, 60008-1-Ig, ProteinTech) and GAPDH (1:1000, #SC-32233, Santa Cruz, USA). After washing with TBST twice, the membranes were incubated with HRP-conjugated IgGs (1:5000, #SA00001-10, #SA00001-2, ProteinTech) for 1 h at 37°C. Bands were visualized using ECL reagents (Thermo Fisher, USA) and analyzed with a gel analysis system (Tanon; Shanghai, China).
DNA methylation analysis by Reduced Representation Bisulfite Sequencing (RRBS) on Genechem platform
BMSCs were cultured on 6-cm dishes at 37°C for 72 h, marked as WT and SETD4 KO groups (n = 3). Cells were harvested and immediately frozen in liquid nitrogen for 30 min and sent to Genechem Co, Ltd. (Shanghai, China), to assess the genomic DNA methylation status. The experimental protocol steps were as follows: (1) 500 ng genome DNA in each group was digested overnight at 37°C using restriction enzyme Msp1 (Sigma Aldrich) in order to enrich the CpG islands and other CpG methylation-intensive areas. (2) The digested product was purified using an Axygen PCR Cleaner Kit; (3) Repair was ended, and A was added to 3'-terminal of product; (4) Product was re-purified using the Axygen PCR Cleaner Kit (Corning); (5) Methylation linker was added; (6) Agarose electrophoresis and DNA fragments with sizes ranging from 160 to 400 bp were extracted using a GeneJE T Gel Extraction Kit (ThermoFisher Scientific); (7) Bisulfite treatment was conducted using an EZ DNA Methylation-Gold kit (Zymo Research, USA); (8) Bisulfite-converted library with conversion rate > 98% was subjected to PCR amplification, magnetic bead purification and Qubit measurement;(9) Single-read sequencing was conducted using an Illumina Hiseq. The raw data obtained by Illumina Hiseq sequencing were converted into sequence data by Base Calling, and the results were stored in FASTQ file format. Clean reads were compared with reference mouse genome Mus_musculus. GRC38. After the quality check, the R package methylKit was used to analyze the differential methylation status and functional annotation, which include coverage of different CpG, distribution of differential methylated CpG, distribution of CpG in different characteristic regions, difference in CpG methylation between different samples and differential methylation regions (DMRs). David Online Software was adapted to document genes’ function (GO enrichment and annotation) and signal pathways (KEGG signaling enrichment and annotation).
Statistical analysis
Statistical analyses were conducted using GraphPad Prism (Version 7.0, GraphPad Software, CA, USA). Data are expressed as means ± SEM. Differences between two groups were analyzed using umpired Student’s t tests. For comparisons between multiple groups, ANOVAs were used followed by Tukey’s multiple comparisons test. P<0.05 was considered to be statistically significant.