The study was approved by the Ethical Committee of the Medical Faculty of the Christian-Albrechts-University, Kiel, Germany. When using new samples, starting on 25-06-2014, consent forms were signed specifically for the current studies (D421/14). We also had access to retrospective samples where patients gave a general consent in order to use clinical data and biomaterial for research on DSD (D401/14). The Ethical Committee approved the use of retrospective samples under the premise of complete anonymization i.e. not having access to any personal data. All GF included in this study were double encrypted. All individuals in the reference group had documented normal male external genitalia.
Cell lines, DNA, plasmids
Genital skin fibroblasts (GSF) GSF-26, GSF-22 (control scrotal cells) and GSF-122, GSF-128 (control foreskin cells) as well as patient cells GSF-104 and GSF-163 were maintained in phenol red free Dulbecco´s modified Eagle´s medium (Life Technologies) supplemented with 10% fetal bovine serum (FBS; Biochrome), 100 units/ml penicillin/streptomycin, 2 mM L-glutamine (Biochrome) and 20 mM HEPES buffer (Life Technologies). NIH3T3 cells were maintained in DMEM (Gibco) supplemented with 10% FCS (ThermoFisher) and 100 units/ml penicillin/streptomycin. LNCaP cells were cultivated in RPMI 1640 media (Gibco) supplemented with 10% fetal bovine serum (Biochrome) and 100 units/ml penicillin/streptomycin (P/S).
DAAM2 wt and N614fs were cloned into pmScarlet backbone by Gibson cloning technique (NEB). The following primers (5´à 3´) were used for cloning of DAAM2-wt-mScarlet:
backbone.rev: ggtggcaagcttgagctcgag; backbone.fwd: ggggatccaatggtgagcaagggcg;
DAAM2.rev: gcctcgcccttgctcaccattggatccccataatttagccggtttattgcccgc;
DAAM2.fwd: ctcgagctcaagcttgccaccatggccccccgcaagaggag
Following primers were used for Gibson cloning of DAAM2-N614fs-mScarlet plasmid:
backbone.rev: ggtggcaagcttgagctcgag backbone.fwd: ggggatccaatggtgagcaagggcg
N614.fwd: ctcgagctcaagcttgccaccatggccccccgcaagaggag
N614fs.rev: gcctcgcccttgctcaccattggatcccctgtcagcttcacccagttgaaggacttc
DAAM2-D165E-mScarlet was obtained by a Quick-change PCR of the DAAM2-wt-mScarlet construct with the following forward primer: cggagcatggagcacgccacc
Next, si-DAAM2 (Qiagen, Hs_DAAM2_6 (NM_001201427, NM_015345) binding site gttacccgggagcgggcaataaac was mutated with a Quick change PCR using following primer for DAAM2-wt-mScarlet and DAAM2-D165E-mScarlet to obtain si-resistant DAAM2 plasmids: gttacccgggaacgggcaataaac
Since the shorter frameshift mutant (N614fs-mScarlet) is lacking the binding site (AA1057-1067) for the human si-RNA used in this study, we did not have to modify any si-RNA binding sites for this plasmid.
Arpin (26) was amplified with a nuclear localization sequence. Additionally, mScarlet was amplified and both fragments subcloned into pBMN backbone using the following primers via Gibson cloning technique:
mSc_fwd: gatccaccggtcgccaccatggtgagcaagggcgaggcag
mSc_rev: gctcatacaagcttgagctcgagatctgagtccggacttgtac
Arpin_fwd: acaagtccggactcagatctcgagctcaagcttgtatgagc
Arpin-NLS_rev: cactgtgctggcggccgctctatacctttctcttcttttttggtccgtcatcccactcctcgtc
pBMN_fwd: agcggccgccagcacagtg
pBMN_rev: ggtggcgaccggtggatccg
NLS-d.n.Arp2 was a gift from O. Fackler 27
Bacterial protein expression and purification
AR-CT was cloned from pCDNA-AR-CT and inserted into a modified pET-28a plasmid, in which GST was inserted into C-terminus, by Gibson assembly (NEB) using following primers:
AR-CT Fwd: 5'-gtcgacaagattacaaggatgacgatgacaagggaatggaagtgcagttagggctggg-3'
AR-CT Rev: 5'-cgagtgcggccgcaagcctgggtgtggaaatagatgggcttgac-3'
pET-28a Fwd: 5'-gcttgcggccgcactcg-3'
pET-28a Rev: 5'-catccttgtaatcttgtcgacggagctcgaattcggatc-3'
All the plasmids were transformed in BL21-CodonPlus cell. Protein expression was induced by adding 1 mM IPTG (Merck) when the absorbance of cell culture reached 0.6-0.8, followed the 16 h incubation at 16℃. After harvesting the cells by centrifugation at 4000 rpm for 20 min, pellet expressing EGFP-H2B or GST was lysed by sonication in TBS buffer (20 mM Tris-HCl, 150 mM NaCl, 1 mM β-Mercaptoethanol) and purified by Protino Ni-IDA Resin (MN)(EGFP-H2B) or Protino Glutathione Agarose 4B (MN) (GST). Pellet expressing AR-CT was lysed by sonication in TEGM (10 mM Tris-HCl, 1 mM EDTA, 10% glycerol, 10 mM molybdate, pH 7.4) and purified by NTA beads. Pellet expressing mDia1-Ct was purified as described in 28.
APOD assay
The assay protocol was published previously 2. For hormone induction experiments, typically 1.4x105 cells were plated in 60 mm dishes each and incubated at 37°C with 5% CO2. After 24 h, the dishes were washed three times in the above medium without FBS and were further grown in culture medium supplemented with 0.1% charcoal treated FBS. The dishes were treated as follows: to the first dish non aromatizable DHT (Sigma-Aldrich) dissolved in 100% ethanol was added to a final concentration of 10 nM. An equal volume of ethanol (EtOH) was added to the second dish. Cells were left for 72 h under the above described conditions at 37°C with 5% CO2 after which they were lysed in RNA-extraction buffer (RLT; Qiagen). DHT was regularly tested for purity and concentration using mass spectrometry.
RNA isolation, amplification and detection
Total RNA was isolated from fibroblasts using the RNeasy kit (Qiagen). Typically, 500 ng of total RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen). Quantitative PCR was performed in duplicate for each sample with the QuantiTect SYBR Green master mix (Qiagen), using specific primers for APOD, DAAM2 and SDHA (succinate dehydrogenase complex flavoprotein subunit A) as a housekeeping gene. All primers were purchased from Qiagen and used following the manufacturer´s instructions. qPCR data were analyzed using the formula R= 2 – (deltaCP), where R is the relative expression and deltaCP is the difference between APOD or DAAM2 and SDHA expression.
15 x 104 LNCaP cells per well were seeded in a 6-well dish in RPMI 1640 media (Gibco) supplemented with 10% fetal bovine serum (Biochrome) and 100 units/ml penicillin/streptomycin (P/S). Non aromatizable DHT (Sigma-Aldrich) dissolved in 100% ethanol was added to a final concentration of 10 nM in RPMI 1640 media supplemented with 10% charcoal stripped FBS (ThermoFisher) and P/S and applied to desired wells. An equal volume of ethanol (EtOH) was added to the control well. 16 h after DHT addition wells were treated with either 5% 1,6-Hexanediol (240117, Sigma-Aldrich) for 5 min at RT or 40 nM Swinholide A (19611, Cayman Chemicals) for 30 min at 37°C, 5% CO2. After treatments, cells were washed gently with PBS and RPMI 1640 medium with 10% charcoal stripped FBS and DHT or EtOH was added for another 7 hours at 37°C, 5% CO2. 24h after first DHT addition and treatments in between, cells were lysed in RNA-extraction buffer (RLT; Qiagen).
Total RNA was isolated from LNCaP cells using the RNeasy kit (Qiagen). Following the same methods as described above, specific primers for PSA (prostate specific antigen) and human GAPDH (glyceraldehyde-3-phosphate dehydrogenase) as housekeeping gene were used. Primers were blasted for specificity and purchased from biomers.
RNA interference
3 x 104 GSF cells were seeded per 12 well in 12 well dishes in phenol red free Dulbecco´s modified Eagle´s medium (Life Technologies) supplemented with 10% fetal bovine serum (FBS; Biochrome), 100 units/ml penicillin/streptomycin, 2 mM L-glutamine (Biochrome) and 20 mM HEPES buffer (Life Technologies) and grown at 37°C with 5% CO2. The next day an siRNA on target plus smart pool against human DAAM2 (L-041010-00-0005; Dharmacon) and an on target plus non-targeting pool (D-001810-10-05, Dharmacon) were added to the cells at a final concentration of 10 nM together with DharmaFECT 1 (T-2001-01; Dharmacon) transfection reagent according to the manufacturer´s instructions. After 24h cells were washed three times in the above medium without FBS and were further grown in culture medium supplemented with 10% charcoal treated FBS and non aromatizable DHT (Sigma-Aldrich) dissolved in 100% ethanol at a final concentration of 10 nM or an equal volume of ethanol (EtOH). Cells were left for 72 h under the above described conditions at 37°C with 5% CO2 after which they were lysed in RNA-extraction buffer (RLT; Qiagen).
150.000 LNCaP cells/well were seeded in a 12-well plate for Luciferase gene reporter assays and transfected the next day with either 30 pmol control si-RNA (Qiagen), 30 pmol si-RNA directed against human DAAM2 (Qiagen, Hs_DAAM2_6 (NM_001201427, NM_015345) or 30 pmol si-RNA directed against human Diaphanous 3 (Qiagen, Hs_DIAPH3_8; NM_001042517 NM_030932; CTCCGGCACAATTCAGTTCAA) using RNAiMax (Thermofisher). 24h after si-RNA transfection LNCaP were transfected with reporter plasmids as well as DAAM2-rescue plamids and assay was performed 48 h after si-RNA transfection (also see section “PSA-Luciferase gene reporter assay”).
250.000 cells per well NIH/3T3, stably expressing the nuclear actin chromobody-mCherry (nAC-mCherry) were seeded into a 6-well plate. The next day cells were transfected with either 30 pmol control si-RNA or 30 pmol si-RNA directed against mouse Daam2 (Qiagen; Mm_DAAM2_2 NM_001008231) using RNAiMax (ThermoFisher). 24 h after transfection cells were split into 35mm glass bottom dishes (Greiner) and a new 6-well for WB analysis of Daam2-knockdown. Live cell imaging and collection of lysates for WB analysis were performed 72 h after si-RNA transfection (also see section “Microscopy, live imaging and image analysis”).
PSA-luciferase gene reporter assay
300.000 LNCaP wt cells/well were seeded in a 6-well plate in RPMI 1640 media (Gibco) supplemented with 10% fetal bovine serum (Biochrome) and 100 units/ml penicillin/streptomycin (P/S). The next day cells were washed carefully three times with 1x PBS before changing the medium to RPMI 1640 media supplemented with 10% charcoal stripped FBS (ThermoFisher) and P/S. The next day all wells were transfected with 200 ng pRLTK-Renilla-Luc and 400 ng pGL3-PSA-Luc per well using Lipofectamine 3000 (ThermoFisher). Co-transfection of additional plasmids were as followed:
PSA reporter assay NLS-actin R62D: 400 ng NLS-BFP-actin R62D-myc, 800 ng NLS-BFP-actin R62D myc, 400 ng NLS-BFP-myc; control wells: 800 ng pLink each to equal transfected DNA amount.
PSA reporter assay Arp2/3 complex & Exportin-6: 500 ng NLS-Arpin-mScarlet, 500 ng NLS-d.n.Arp 2-mCherry, 300 ng Exportin-6-mCherry; control wells: 500 ng pLink each to equal transfected DNA amount. 5 h after transfection 2 ml of 20 nM DHT in RPMI 1640 media supplemented with 10% charcoal stripped FBS and P/S was added carefully and dropwise to the wells, except one well which was treated with 0.1% Ethanol in RPMI 1640 media supplemented with 10% charcoal stripped FBS and P/S. With the existing 2 ml of RPMI 1640 media supplemented with 10% charcoal stripped FBS (ThermoFisher) and P/S in the wells, we achieved a final concetration of 10 nM DHT in each well. 24 h after DHT addition cells were lysed and assay performed as described below.
For si-RNA based PSA-Luciferase gene reporter assay 150.000 LNCaP wt cells/well were seeded in a 12-well plate. The next day cells were transfected with either 30 pmol control si-RNA (Qiagen), 30 pmol si-RNA directed against human DAAM2 or 30 pmol si-RNA directed against human Diaphanous 3 (see section “RNA interference”) using RNAiMax. 5 h after transfection cells were carefully washed three times with 1x PBS and medium was changed to RPMI 1640 media supplemented with 10% charcoal stripped FBS and P/S. The following morning cells were transfected with reporter plasmids as described above and co-transfected with 500 ng si-RNA resistant DAAM2-wt-mScarlet, DAAM2-D165E-mScarlet or DAAM2-N614fs-mScarlet plasmids. Control wells and si-DIAPH3 treated wells were transfected with 500 ng pLink each to reach equal DNA amounts in all wells. 5 h after transfection 1 ml of 20 nM DHT in RPMI 1640 media supplemented with 10% charcoal stripped FBS and P/S was added carefully and dropwise to the wells, except one well which was treated with 0.1% Ethanol in RPMI 1640 media supplemented with 10% charcoal stripped FBS and P/S. With the existing 1 ml of RPMI 1640 media supplemented with 10% charcoal stripped FBS (ThermoFisher) and P/S in the wells, we achieved a final concetration of 10 nM DHT in each well. 24 h after DHT addition medium was aspirated and cells were lysed in 200 µl (6-well) or 100 µl (12-well) Triton lysis buffer (0.15 M Tris, 75 mM NaCl, 3 mM MgCl2, 0.25% Triton X-100) for 10 min on ice with occasional shaking. Cells were scraped and centrifuged at full speed and 4°C for 10 min. 20 µl of each lysate were pipetted into a 96-well plate. 50 µl of firefly buffer (15 mM DTT, 0.6 mM coenzyme A, 0.45 mM ATP, 4.2 mg/ml D-luciferin) was added simultaneously into the lysates and luminescence was measured after 10 seconds. Following 75 µl of renilla buffer (45 Mm EDTA, 30 mM Na4P2O7, 1.425 M NaCl, 0.06 mM PTC124, 0.01 h-CTZ) were added to stop the reaction and luminescence was measured again. Afterwards, final luciferase values were determined with the following equation and normalized to the ethanol control:
Afterwards 5x Laemmli sample buffer was added to the lysates, heated up at 95°C for 10 min, centrifuged for 3 min and conducted to WB analysis. Protein expression and knockdown efficiency were detected using following primary antibodies: anti-myc (CST, 2272S); anti-Histone H3 (CST, 4499S); anti-mCherry (CST, ED8F), anti-RFP (Rockland, 600401379); anti-GAPDH (Millipore, 3587127); anti-alpha tubulin (CST, 2125S); anti-DAAM2 (abcam, ab169527) & anti DIAPH3 (proteintech, 14342-1-AP).
Whole cell protein extracts, biochemical fractionation and protein detection
For protein extractions GSF cells were grown in phenol red free Dulbecco´s modified Eagle´s medium (Life Technologies) supplemented with 10% fetal bovine serum (FBS; Biochrome), 100 units/ml penicillin/streptomycin, 2 mM L-glutamine (Biochrome) and 20 mM HEPES buffer (Life Technologies) at 37°C with 5% CO2 to a confluence of 70-80%. For whole cell extracts, cells were washed once in ice-cold PBS, resuspended in ice-cold RIPA buffer supplemented with complete protease inhibitors (CompleteTM Roche). After 10 minutes centrifugation at 15.000 g and 4°C, the supernatant was transferred into a fresh tube and snap frozen on dry ice. For biochemical fractionation, cells were washed three times in the above medium without FBS and were further grown in culture medium supplemented with 10% charcoal treated FBS. Cells were treated with non aromatizable DHT (Sigma-Aldrich) dissolved in 100% ethanol at a final concentration of 10 nM or an equal volume of ethanol (EtOH). Cells were left for 48 h under the above described conditions at 37°C with 5% CO2. Protein fractionation was performed as described before 19. Cells were washed with ice cold phosphate-buffered saline (PBS), scraped in ice cold PBS and centrifuged for 10 min at 800g. The pellet was kept on dry ice for 45 min after which it was dissolved in 5x volume of buffer P1 (10mM HEPES, 0.1mM EGTA, 1mM DTT, complete protease inhibitors (CompleteTM Roche)) and kept for 10 min on ice. After addition of Triton X-100 (final concentration 0.5%), samples were vortexed for 10 s, followed by the sedimentation of the nuclei at 10,000g for 10 min. The supernatant was kept at -80°C as cytoplasmic fraction. The pellet was washed twice with buffer P1 and lysed in 5 x volume of buffer P2 (20 mM HEPES, 25% glycerol, 400 mM NaCl, 1 mM EGTA, 1 mM DTT, complete protease inhibitors (CompleteTM Roche)) for 90 min on a rotary shaker at 4°C followed by 30 min centrifugation at 16,000 g. The supernatant was kept at -80°C as nuclear fraction. Protein extracts were separated by SDS-PAGE on a NuPAGE® Novex® 4-12% Bis-Tris Protein gel (Life Technologies) and transferred to a nitrocellulose membrane (Whatman, GE Healtehcare Life Sciences). The membrane was blocked for 1-2 h at room temperature with TBS containing 0.1% Tween and 5% non-fat dry milk. All primary antibodies were used over night at 4°C: Anti-AR F39.4.1 antibody (BioGenex) (1:100 dilution), Anti-Actin (A 2066) antibody (Sigma-Aldrich) (1:10.000 dilution), Anti-DAAM2 antibody (ab169527, abcam) (1:1.000 dilution), Anti-TAF15 antibody (ab134916, abcam) (1:10.000 dilution), Anti-TUB antibody (T5168, sigma) (1:10.000 dilution). Secondary anti-rabbit and anti-mouse antibodies (Immuno Reagents Inc.) were incubated for 1-2 h at room temperature (1:4.000 dilution). All antibodies were resuspended in TBS containing 0.1% Tween and 5% non-fat dry milk. Signals were detected with the Biorad Chemidoc imaging system using the Clarity Max Western ECL Substrate (Biorad). Quantification of signals was performed using the Image Lab software 6.0.1 (Biorad Technologies).
Yeast two hybrid
Yeast two hybrid screening was performed as described previously 29. In brief, RNA of male mouse genital tubercles at the beginning of external genital development at embryonic day 15 and 16 (E15, screening A/ E16, screening B) were extracted. Independent cDNA libraries of each embryonic day were constructed using the Matchmaker Library Construction and Screening Kit (Clontech) and fused to the GAL4-AD in pGADT7-Rec by cotransfection into the yeast strain AH109. Vector pGBKT7-AR555 containing the C-terminal part of the AR (amino acid 555-920) containing the DNA-binding domain (DBD), hinge region and ligand binding domain (LBD) was used as a bait. Plasmids of colonies grown after 3-5 days at 30°C were recovered and inserts of pGADT7-Rec were identified by sequencing. AR-binding of fusion proteins of purified plasmids was verified by retransformation into yeast strain AH109 together with the bait used in the screening or with pGBKT7-AR645 containing a shortened AR-bait containing only the ligand binding domain (LBD, aa 645-920). The empty pGBKT7 vector was used as a negative control.
In-vitro Co-sedimentation assay
In order to identify whether the purified c-terminal Androgen receptor protein (AR-Ct-GST) directly binds to F-actin, G-actin (10 μM, Cytoskeleton Inc.) was incubated with either purified AR-Ct-GST (15 μM), mDia1-Ct (5 μM), GST (5 µM) or EGFP-H2B (5 µM) for 1 h at room temperature in F-buffer (5 mM Tris-HCl pH 7.5, 100 mM KCl, 1 mM MgCl2, 0.2 mM CaCl2, 0.2 mM EGTA, 0.2 mM ATP and 0.5 mM DTT) with a total volume of 100 μl. GST, as well as EGFP-H2B were used as negative controls whereas mDia1-Ct was used as the positive control sample. After ultracentrifugation at 80.000 g for 30 min, 96 μl supernatant was removed as the nonpelleted fraction (S) and boiled in 24 μl 5X Laemmli buffer. The pellet (P) was washed one time with F-buffer, then resuspended and boiled in 120 μl 1X Laemmli buffer. 20 μl of each sample was loaded into the SDS-PAGE gel. Furthermore, the same lysates from the aforementioned AR-Ct-GST experiment were subjected to Western Blot analysis and incubated with an antibody recognizing the c-terminus of the AR (Androgen receptor antibody C-terminal antigen; Cellsignaling #54653S).
Immunofluorescence
6 x 104 cells were seeded per 6 wells in 6-well dishes in phenol red free Dulbecco´s modified Eagle´s medium (Life Technologies) supplemented with 10% fetal bovine serum (FBS; Biochrome), 100 units/ml penicillin/streptomycin, 2 mM L-glutamine (Biochrome) and 20 mM HEPES buffer (Life Technologies) and grown at 37°C with 5% CO2. After 24 h cells were washed three times in the above medium without FBS and were further grown in culture medium supplemented with 10% charcoal treated FBS and non aromatizable DHT (Sigma-Aldrich) dissolved in 100% ethanol at a final concentration of 10 nM or an equal volume of ethanol (EtOH). Cells were left for 24 h under the above described conditions at 37°C with 5% CO2. For Swinholide A (19611, Cayman Chemicals) treatment a final concentration of 40 nM in culture medium supplemented with 10% charcoal treated FBS was used and left for 30 min at 37°C with 5% CO2. 1,6-Hexanediol (240117, Sigma-Aldrich) was used at a final concentration of 5% in culture medium supplemented with 10% charcoal treated FBS and left for 5 min at room temperature. Cells were washed subsequently with PBS and fixed 10 min in 4% formaldehyde solution (28906, Thermo Fisher Scientific) at room temperature. Formaldehyde was washed out with PBS and cells were blocked for 1 h with 2% BSA () and 0.2% Triton X-100 () at room temperature. Cells were washed again with PBS before adding primary antibodies diluted in 2% BSA and 0.2% Triton X-100: Anti-AR F39.4.1 (BioGenex) (1:100), Anti-DAAM2 (ab169527, abcam) (1:100), Anti-RNA Pol II CTD phospho Ser5 (61986, Active Motif) (1:300), Anti-RNA polymerase II CTD repeat YSPTSPS (Ser2P) (ab193468, abcam) and left for 1-2 h at room temperature in a humid chamber. Cells were washed 5x with PBS before adding the fluorescent labeled secondary antibodies diluted in 2% BSA and 0.2% Triton X-100: Alexa Fluor 594 goat anti-mouse IgG(H+L) (A-11005, Thermo Fisher Scientific) (1:500), Alexa Fluor 488 goat anti-rabbit IgG(H+L) (A-11008, Thermo Fisher Scientific) (1:500), Alexa Fluor 647 goat anti-Rat IgG (H+L) (A-21247, Thermo Fisher Scientific) (1:400) and left for 1 h at room temperature in a dark humid chamber. Cells were washed 3x with 0.1% Tween 20 in PBS, 1x with PBS and 1x with distilled water. Cells were mounted with 1.5 µg/ml DAPI in antifade mounting medium (Vectashield H-1000, Biozol).
Microscopy, live imaging and image analysis
Images were generated using ELYRA7, structured-illumination-microscropy with 3D Lattice SIM (Zeiss), equipped with a 63x 1,4 Oil DIC objective, Pecon incubation chamber ensuring 37°C and 5% CO2 and processed using Zen black software (Zeiss). For SIM reconstruction the theoretical OTF given by the manufacturer was used and the automated Wiener-Filter-strength given by the “Standard” end-criterion of the manufacturer was applied. Thus, Values for Wiener-Filter varied closely around 10(-10) for all samples and in all channels. Baseline-shift was used for all reconstructed images as a standard. Thus, the threshold was set into the appearing first peak in the histogram for representative images but no grey-values of the histogram were influenced or cut off for further quantitative analysis. Maximum resolution enhancement by minimal artifact structure (honeycomb-interferences with the sample) was targeted. This was achieved by constantly using “baseline-shift” method and comparing background patterns with structure-signals.
For 3D-reconstruction of droplets and 3D-colocalization quantifications, cells were treated and stained as indicated and imaged as z-stack with 0.091 µm interval. Each z-stack was processed using Imaris software 64x 9.9.0 and displayed as maximum intensity projection (MIP). Droplet size was quantified in Imaris, enabling detection of number and size of single droplets in the nucleus. For quantification of DAAM2 droplet volumes, we excluded droplets smaller than 0.0185 µm3 due to limitation in z-resolution. Brightness and contrast were applied equally to all images, prior to quantification.
For 3D-colocalization between AR and DAAM2 we used the “Coloc-Tool” of Imaris identifying double positive voxels. Thresholds for the analyzed channels were determined in DHT-treated cells by the 'Calculate Thresholds' function in the Imaris- Coloc-tool and applied to all other images equally. This function is based on the algorithm by 18 which has been commercialized by Bitplane AG (Zurich, Switzerland). As a variation to the published algorithm the sample distribution of the Pearson's ”r” was differently randomized. Sample distribution was approximated by Gaussian distribution with a mean of 0 and a variance of n/N with n= number of voxels in the point spread function (PSF) and N = number of all voxels. Following, a new colocalization-channel was generated and 3D rendered by Imaris. Numbers, as well as volumes were quantified using the “surface tool” of Imaris.
For 3D-colocalization between DAAM2 and RNA Pol-II together with the AR, threshold between DAAM2 and RNA Pol-II was determined again using the 'Calculate Thresholds' function' and applied to all images. A fluorescence-based mask was used to set the region of interest (ROI) for the AR, thereby just detecting overlapping fluorescence of DAAM2 and RNA Pol-II in this ROI. Following, a new colocalization-channel was generated and 3D rendered by Imaris. Further analyzation for numbers, as well as volumes, was performed using the “surface tool” of Imaris and displayed as volume heat maps.
For live cell imaging NIH3T3, stably expressing nuclear actin chromobody-mCherry (nAC-mCherry), were seeded in DMEM (Gibco) supplemented with 10% FCS and P/S in a 6-well (Greiner) at 37°C and 5% CO2. The next day 30 pmol of control si-RNA and si-DAAM2 (Qiagen; Mm_DAAM2_2 NM_001008231) were transfected. 24 h after transfection cells were split into 35mm glass bottom dishes (Greiner). 48 h after si-RNA transfection 500 ng of AR-GFP in Opti-MEM (ThermoFisher) were transfected using FuGENE (Promega), following manufacturer’s instructions. 5 h after transfection, medium was changed to 10 nM DHT in DMEM supplemented with 10% charcoal stripped FCS and P/S. 72 h after si-RNA transfection and 16h after addition of DHT imaging was performed. For quantification of actin positive AR droplets, videos were processed using sliding processing (Burst-mode, Zeiss) and first timepoint of each video was analyzed. Using the “spots tool” of Imaris, actin and AR droplets were detected independently as single spots. Following, all actin spots within 100 nm proximity from the center of AR spots were filtered and assigned as actin-positive AR droplets and plotted as percentage of total AR droplets.
LNCaP cells were seeded in RPMI 1640 media (Gibco) supplemented with 10% fetal bovine serum (Biochrome) and 100 units/ml penicillin/streptomycin (P/S) in a glass bottom dish (Greiner). The next day, cells were transfected with AR-GFP, DAAM2-mScarlet and nuclear actin chromobody-SNAP (nAC-SNAP) using Lipofectamine 3000, following manufacturer´s instructions. 5 h after transfection medium was changed to RPMI 1640 media supplemented with 10% charcoal stripped FBS (ThermoFisher) and P/S as well as 10 nM DHT. 30 min prior to imaging SNAP-cell 647-SiR (NEB) was added to label SNAP-tag. Live cell videos were acquired as single plane videos with the minimal time interval and further processed using sliding processing (Burst-mode, Zeiss) resulting in a temporal resolution of 18 frames/ second.
Next generation sequencing library preparation and sequencing
For exome sequencing, a sequencing library was created using Sure Select Human All Exon V6 technology (Agilent) and sequencing was performed at the Cologne Center of Genomics (CCG) on an Illumina platform with paired-end sequencing at a read length of 150 nucleotides. On average, 86% of the target regions were covered 30x and 97% of the target regions were covered 10x. The sequencing data were annotated and quality-checked according to an in-house pipeline and evaluated using the varbank software (CCG) (https://varbank.ccg.uni-koeln.de/). The following filters were used for the evaluation: exclusion of low complexity regions, maximum allele frequency of 0.01% according to gnomAD (https://gnomad.broadinstitute.org), maximum in-house allele frequency of 0.1%, minimum 6-fold coverage. Candidate genes were checked in the UCSC browser for their conservation and the CADD score (Combined Annotation Dependent Depletion) 30.
First, the sequencing data were analyzed separately and checked for homozygous, hemizygous and possible compound heterozygous changes. This resulted in a number of 10-30 changes per patient. These were checked again for their sequencing quality. All genes were subjected to a literature search. For this purpose, search terms for the respective candidate gene were entered separately in PubMed‐NCBI and in the Cardiff Human Gene Mutation Database in connection with sex development in general and androgen resistance or androgen receptor in particular, and positive hits were tabulated. This reduced the number of the candidate genes to 1-3 per patient. Due to their high number, heterozygous sequencing variants were specifically screened for known DSD genes. A list of the known DSD genes was compiled from publications 31,32. In parallel, all samples were analyzed simultaneously and subjected to a phenotype-ontology analysis. The web tool Phenomizer was used for this 33. PAIS (ORPHA:90797) was used as the Human Phenotype Ontology (HPO) term because all included patients had a clinical diagnosis of partial androgen resistance.
Sanger sequencing of the AR was performed on the ABI 3130 Genetic Analyzer (Applied Biosystems).
Statistics
Statistical analysis was performed using Graph Pad 9.3. Data are presented as column bar graph ± SD, scatter dot bar plot with mean ± SD or violin plots showing all data points with median and quartiles. Statistical significance was evaluated with one-way ANOVA for multiple comparisons. For comparison of two groups data two-tailed t-test was used, when data were normally distributed. If data were not normally distributed a Mann-Whitney t-test was performed. Statistical significance is indicated as *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.