Study design and sample collection
The study populations were included apparently healthy goats brought from different areas of the region and sold for the community for the slaughtering purposes. A total of 40 nasal swab samples were taken from nostrils of goats. Briefly, the samples were selected using simple random and purposive sampling techniques from four herds of live goat in the city for this study. The cotton swabs were inserted into the anterior nares of both left and right nostrils and softly rolled against the inner walls. One swab were used to take a sample from both nostrils then stored in Tryptone soy broth (Pancreatic digest of casein, 17g/l; enzymatic digest of soybean, 3g/l; NaCl, 5g/l; K2HPO4, 2.5 g/l and Glucose, 2.5 g/l at 37oC and pH 6.8±0.2). The samples cultures were then transported to the Department of Applied Biology microbiology laboratory using ice box. Finally, the samples were incubated at 37°C for 24 hours until isolation and screening will be performed.
Preliminary screening for possible isolated of Staphylococcus species
Preliminary screening such as catalase test, Indole test, methyl red, motility test, and urease test for PSSIs, and Vogues Proskauer were performed.
Catalase test
Catalase test was performed for these newly isolated PSSIs. It was performed following the methods of [27, 28] with modification. Briefly, bacterial isolates were inoculated into LB agar. It was incubated at 37oC for 24h. From 24 h old culture, colony was taken and placed on cover slide. A 1 to 2 drops H2O2 were added to bacterial isolates placed onto coverlid. Bubble gas was formed and considered as positive for catalase enzymes.
Citrate test
Carbon source utilization efficiency was determined using Simmon’s citrate agar (Ammonium dihydrogen phosphate, 1g/l; MgSO4, 0.2g; K2HPO4, 1g/l; Na3C6H5O7, 2g/l; , NaCl, 5g/l; Bromothymol blue, 0.08g/l; and Bacteriological agar, 15g/l at 37oC and 6.8±0.2 pH) prepared according to previous report [29] with little medication. Briefly, in a flask, a 24.28gmsof the dehydrated powder or lab-prepared media was added 1000ml of pure distilled or deionized water. The solution is then heated to bring it to a boiling temperature in order to dissolve the medium completely. The dissolved medium is then dispensed into tubes and sterilized in an autoclave at 15 lbs pressure (121°C) for 15 min. Once the autoclaving process was completed, the tubes were taken out and cooled at a slanted position to a temperature of about 40-45°C. Well-isolated colonies were taken from an 18h culture with a sterile inoculating loop. The citrate agar tubes were inoculated by streaking the surface of the slant. The cap of the test tubes should be left loosened to ensure adequate aeration. The tubes were then incubated aerobically at 37°C for up to 4 days. The change in color was observed.
Indole test
The indole test was performed following the methods of Welsh [30] with modification. Briefly, Tryptone broth (Casein enzymic hydrolysate, 10.0g/l; NaCl 5.0g/l; pH 7.3±0.2 at 25oC) medium was prepared in 1000ml distilled water. Then 10 drops of Kovac’s reagent (v/v) was added into Trypticase soy broth medium and thoroughly mixed. The medium was sterilized at 121oC for 15 min. Then, the sterilized medium was added into glass tube. Then, the pure NCGs isolates were taken using inoculation loops and inoculated into into Trypticase soy broth with Kovac’s reagent. Finally, the color change was examined and recorded on the most tope of the surface of the medium.
Methyl red
Methyl red was conducted following the methods of Welsh[30]. MR-VP broth medium (Glucose phosphate broth) (Pancreatic digest of casein, 3.5g/l; peptic digest of animal tissue, 3.5g/l; Dextrose, 5.0g/l; Mono-potassium phosphate, 5.0g/l at 25°C and 7±0.2 pH) was prepared and gently heated to completely dissolve the ingredients and 5 ml aliquots were transferred into culture tubes. The culture tubes were sterilized via autoclaving at 121°C and 15psi for 15min. the culture was incubated at 37°C for a minimum of 48 hours in ambient air. After incubation 5 drops of methyl red reagent (v/v) was added to MR-VP broth and the color change in the broth medium was observed.
Motility test
The motility test was carried out for the recent isolates these obtained from NCGs. It was conducted following the methods of Welsh [30]. Briefly, SIM agar medium was prepared in 1000ml distilled water. Pure isolates of NCGs was inoculated into labeled test tubes containing SIM agar medium (Peptone, 30.0g/l; Beef extract, 3.0g/l; Peptonized iron, 0.2g/l; Agar, 3.0g/l and Na2S2O3·5H2O, 0.025g/l at pH 7.3 ± 0.2 and 25°) by means of stab inoculation. The cultures were incubated at 37oC for 24h. Finally, the motility was observed weather the growth is restricted or not to the line of inoculation.
Urease test
The urease test was performed following the methods of Welsh [30] with little modification. Briefly, urease test broth (urea, 20.0 g/l; Na2HPO4, 9.5 g/l; KH2PO4, 9.1 g/l; Yeast extract, 0.1 g/l; Phenol red, 0.01 g/l at pH 6.8±0.2) medium was prepared in 1000ml distilled water. The broth medium was thoroughly mixed and filter sterilized. The sterile urease test broth medium was added into sterilized glass tubes. Finally, the pure isolates were taken and inoculated into sterilized urease broth medium and incubated at 37oC.
Vogues-Proskauer test
Vogues-Proskauer test was performed following the methods of Welsh [30] with modification. Briefly, 48h old pure cultures of Staphylococcus species were grown on MR-VP broth medium (Glucose phosphate broth) (Pancreatic digest of casein, 3.5g/l; peptic digest of animal tissue, 3.5g/l; Dextrose, 5.0g/l; Mono-potassium phosphate, 5.0g/l at 25°C and 7±0.2 pH). The broth was gently heated to completely dissolve the ingredients and 5ml aliquots were transferred into culture tubes. The culture tubes were sterilized at 121°C and 15 psi for 15 min. The culture was incubated at 35°-37°C for a minimum of 48hours in ambient air. A 12 drops (0.6ml) of Barritt’s reagent A and 4 drops (0.2 ml ) of Barritt’s reagent B were added into the culture tube. For 30s to 1 min the tubes were carefully shook to expose the medium to atmospheric oxygen. The tubes were allowed to stand for 30 min and examined for color change.
Secondary Screening of Staphylococcus species
Secondary screening methods of Staphylococcus species such as coagulase test, deoxyribonuclease (DNase) test, growth on mannitol salt agar (MSA) medium, Gram staining and morphological Characterization for PSSIs were performed for characterization of Staphylococcus species that obtained from the NCGs.
Coagulase test
Coagulase test was used to differentiate coagulase positive Staphylococci species from coagulase negative Staphylococci species. 0.5 ml of human plasma was taken in to a sterile small test tube (one drop plasma plus nine drops normal saline). A small amount of colony from the growth cultures were emulsified to the plasma tube and incubated at 35oC for 4 hours. Clot formation within four hours was interpreted as positive test for cell free coagulase [31].
DNase test
DNase test were performed to differentiate and identify S. aureus form other Staphylococcus species. The DNase agar (Pancreatic digest of casein, 10 g/l; yeast extract, 10 g/l; deoxyribonucleic acid, 2 g/l; NaCl, 5 g/l; agar, 15 g/l; methyl green, 0.5 g/l and l liter distilled water) for characterization of Staphylococcus species. The test organism was taken from 18h old cultures and inoculated on the prepared DNase agar using a sterile inoculating loop. The plates were incubated at 35-37°C for 24h. The incubated agar plates were flooded with a 1NHCl solution, and the excess acid is tipped off. The plates were observed for a clear zone around the colonies within 5min (source).
Growth on mannitol salt agar medium
Isolation of Staphylococcus species were performed according to previous methods [32] with slight modifications. A loop full of the enriched sample was aseptically spread on freshly prepared Mannitol Salt Agar (MSA) medium (Protease peptone, 10 g/l; Sodium chloride, 75 g/l; D-mannitol, 10 g/l; Beef extract, 1 g/l; Phenol red, 0.025 g/l; and agar, 15 g/l) (Oxoid, UK). These all plates were incubated aerobically at 37oC for 24-48h. The cultures were examined for colony morphology, pigmentation and characteristics of mannitol fermentation. The possible colonies of S. aureus were further cultured onto mannitol salt agar (MSA) and repeatedly sub-cultured to get pure culture. The obtained pure cultures of the isolates were preserved for further bacterial identification.
Smear preparation and gram staining
Gram staining was performed following the methods of Boone et al., (2001). Briefly, cleaned microscopic slides were taken. One drop of sterile distilled water was placed in the center of microscopic slide using a micropipette. Using an aseptic technique a very small part of a single colony was taken and transferred from solid medium to distilled water drop on microscopic slide using sterilized loops. A thin smear was carried out and allowed to air dry at room temperature. It was fixed by passing the slides through the Bunsen burner flame for two-three times. The heat-fixed smears were placed on the staining rack and covered with crystal violet and left for one minute. The slide was washed gently with tap water and covered with Gram’s iodine for one minute and the iodine was washed off by tilting the slide. The smear was decolorized with ethyl alcohol for about 15s and immediately washed with water. The smear was covered with safranin for one minute and washed with tap water. Finally, the smear was blotted and dried in the air to examine under the oil immersion objective.
Identification of Staphylococcus species using MALDI-TOF MS
The all isolates initially screened using biochemical tests and shown characteristics feature of Staphylococci species were subjected for identification using Matrix-assisted laser desorption ionization time flight mass-spectroscopy (MALDI-TOF MS). All isolate classifications were carried out using the direct transfer method (MALDI Biotyper 3.1. User Manual, Bruker Daltonics Inc.).The representative single colonies of the possible Staphylococci isolated were smeared as a thin film directly into a spot on MALDI targeted plate using tooth applicator. The MALDI target plate was overlaid with 1μl of 70% (v/v) of formic acid and allowed to dry at a room temperature. Immediately the spot was overlaid with 1μl of matrix solution α-cyano-4-hydroxycinnamic acid in 50% (v/v) acetonitrile (HCCA) solution and allowed to dry at room temperature. The resulting spectra were compared with reference spectra by using the Biotyper 3.1 software (Bruker MALDI Biotyper, UK). The identification score cutoff values were applied to each measurement according to the manufacturer’s instructions. Isolates with a score of ≥2.0 for a given species were considered adequately identified to the species level as prescribed by Tomazi et al. [33]. E. coli was used as a standard for calibration and quality control.
Physiological characterization of S. aureus for growth kinetics
The isolated strains were tested for determination of generation time, and specific growth rate in Tryptone soy broth (TSB). Briefly, a single colony of the pure bacterial isolates inoculated into 5ml of nutrient broth and incubated for 12h to prepare the pre-culture. A 2mL of this overgrown culture was aseptically transferred into a flask containing 250mL of sterile TSB medium and incubated at 37oC at 150 rpm. A 3ml of sample aliquots were aseptically taken out every one hour interval and immediately refrigerated at 4oC for turbidometric analysis, viable cell count and obtained biomass.
The subsequent suitable dilutions were made in the Eppendorf tube. 900μL dilution blanks were arranged and labeled as 10-110 -210 -3 and -10-6 in Eppendorf tube. A 100μl of the sample was transferred from the first dilution blank using a pipette and mixed by the vortex. The sequential transfer and mixing were continued to the last dilution. The plate was divided into four equal sectors. From the selected dilution factor, 20μl of the diluted sample was dropped to the surface of the dried nutrient agar plate by a fresh tip. Each drop was added in separately numbered sectors on the nutrient agar plate in triplicate. The sample was allowed to dry and incubated in an inverted position for 18-24h. The acceptable colony-forming units (CFU/ml) at a dilution factor per 20μl were calculated by the formula given in the equation one. The generation time was calculated according to the formula given in equation two.
CFU/mL= (No. of colonies X dilution factor)/Volume of culture plate………….……(1)
Where, CFU is colony forming unit
G=t/3.3logb/B………………………………………………………………………..… (2)
Where, G is generation time, t is time intervals in hours or minutes, B is number of bacteria at the beginning of a time interval and b is number of the bacteria at the end of the time interval.
Growth kinetics by measuring turbidity and biomass
The spectrophotometer was switched on and allowed to warm up for 40 minutes. All spectrophotometer was blanked by uninoculated using TSB. The aliquot of undiluted culture was transferred to a 10mm cuvette and the optical density was measured at 600nm. The spectrophotometer was set at 100% transmittance. The contents of the inoculated tube were mixed thoroughly and transferred to a cuvette and the optical density was recorded for each time interval.
Factors affecting the growth of newly isolated Staphylococcus species
Effect of Temperature on PSSI-D8 biomass
A 1L of Luria Bertani’s broth (Tryptone, 10g/l; sodium chloride, 5g/l; yeast extract, 10g/l; and glucose, 2g/l) was prepared. A 250ml of broth medium was poured into 500ml of conical flask and the media was sterilized at 121oC for 15 minutes. After sterilization, 2ml of the isolated Staphylococcus spp. strain were aseptically inoculated into the LB broth medium. The culture was incubated at different temperature (25, 30, 37, and 40 oC) on a rotary shaker at 150rpm for 48 h. Finally the optical density of the culture was reading in triplicate by spectrophotometer at 600nm and the cell dry weight was calculated.
Effect of pH on PSSI-D8 biomass
Effects of various pH value of the medium were prepared to study of the optimum pH for the isolated Staphylococcus aureus. Three 500ml conical flasks each containing 250ml of LB broth (Tryptone, 10 g/l; yeast extract powder, 5 g/l; NaCl, 10 g/l pH 7.2 ± 0.2) (Himedia, Mumbai, India) was set to various pH value (5, 7, and 10) using 1N of HCl and 1N NaOH (40g/l) and autoclaved at 121 oC for 15 min. After sterilization, then 2ml of the isolated Staphylococcus aureus suspensions was inoculated into each adjusted pH and incubated at 37oC on a rotary shaker at 150rpm for 48h. The OD600nm of the culture and CDW (g/ml) were measured at 600nm a wavelength using UV-spectrophotometer (SM-1600) and digital beam balance (ES5200-4), respectively. Finally, the mean value of OD600nm and CDW (g/ml) were calculated for the triplicate data and plotted to identify the optimum pH value for Staphylococcus aureus.
Effect of Salt concentration on PSSI-D8
LB broth was prepared according to the manufacturer’s instruction manual. A 250ml of each of the three media were prepared using different NaCl concentration (1.28M, 1.70M, and 2.13M). Then it was dispensed into three conical flasks and corked tightly. The flasks were labeled and sterilized at 121oC for 15 min. After sterilization the isolated bacterial suspension was inoculated into the three flasks with different NaCl concentration. The inoculated LB broth was then incubated at 37oC on rotary shaker at 150rpm for 48h . At the end of incubation, the CDW (g/ml) and absorbance of the culture (OD at 600nm) were recorded in triplicate by using bean balance (specification) and spectrophotometer (specification), respectively.
Effects of carbon source on pure PSSI-D8
Effects of different types of carbon sources on the growth of staphylococcus aureus were also studied. Minimal salt medium (K2HPO4, 1.73g/l, K2HPO4, 0.68g/l; MgSO4. 7H2O, 0.1g/l; NaCl, 4g/l; FeSO4.7H2O, 0.03g/l; NH4NO3, 1g/l; and CaCl2, 0.02g/l at 37oC and 7.0 pH) . Prior to sterilization the initial pH of media was adjusted to pH 7. The minimal salt media was sterilized at 121oC for 15 min. A 2% (w/v) of different types of carbon sources such as fructose, glucose, mannitol, and sucrose were sterilized separately before being mixed with minimal salt media. Each culture media with different carbon sources were inoculated with newly isolated Staphylococcus species and incubated at 37oC for 48 h using a rotary shaker at 150rpm for. After the incubation time the absorbance of the culture and biomass (CDW, g/ml) was recorded in triplicate using UV-Spectrophotometer (SM-1600) and digital electronic balance (ES5200-4), respectively.
Antimicrobial susceptibility testing
The isolated staphylococcus species were screened for in vitro antimicrobial susceptibility using the disk diffusion method according to the procedure given by [34] The bacterial suspension was prepared in 5ml of Mueller Hinton Broth (Beef infusion from buffalo (300gm), Acid hydrolysate casein (17.5gm), and Starch (1.5gm)) and the turbidity was adjusted to meet 0.5 McFarland turbidity standards (~1.5x108CFU/ml). The isolates were inoculated on Muller Hinton Agar medium (Beef infusion from buffalo, 300g/l; acid hydrolysate casein, 17.5 g/l; starch, 1.5 g/l and agar,17 g/l) and tested against impregnated antibiotics disk such as ampicillin amoxicillin (2μg), kanamycin (30μg) (Oxoid Company, Hampshire, England), nalidixic acid (30μg), oxacillin (1μg), penicillin (10μg), streptomycin (Himedia, India) (25μg), chloramphenicol (Himedia, India) (30μg), and vancomycin (30μg). These impregnated antibiotics disks were symmetrically placed onto the medium by using sterile tweezers. Staphylococcus aureus (ATCC 25923T) was used as a positive control. All antimicrobial susceptibility testing assays were triplicated. After 24h of incubation, the clear zones of bacterial growth around the antibiotic disc diameter for individual antimicrobial agents were measured by (digital antibiotic zone reader, M-10676, India) and then translated into sensitive (S), intermediate (I), and resistant (R) categories according to the interpretation table of the Clinical and Laboratory Standard Institute [35] and VET01-S2 [36].
DNA extraction
DNA extraction was performed using Qiagen DNeasy extraction kit protocol for bacterial culture (Thermo Scientific, Germany). Briefly, newly isolated Staphylococcus species isolates were grown over night at 37oC in brain heart infusion agar (Himedia, India) (g/L) (HM infusion powder, 12.5;BHI powder, 5; Proteose peptone, 10; Dextrose (glucose), 2; Sodium chloride, 5; Disodium hydrogen phosphate, 2.5; and Agar, 15) and final pH (at 25oC) 7.4±0.2). One to two loop full distinct colonies of bacterial isolates were taken and suspended in 600μl of sterile PBS buffer. The suspended bacterial culture was centrifuged (20,0000xg, 5min at 25oC) and the supernatant was discarded and pellet was harvested. The pellet was suspended within 180μL of enzymatic lysis buffer and vigorously vortexed for 10-20s and the cells were incubated at 37oC for 30 min in the water bath. After incubation, 25μl of proteinase K and 200μl of AL buffer were added respectively to the tube and briefly vortexed. The tubes were incubated at 56oC for 30 min in the water bath. After incubation, 200μL of 100% (v/v) ethanol was added and vortexed. Using a micropipette the entire contents of the extracted sample was transferred to the labelled spin column tube and the column was centrifuged (10,000xg, 1 min at 25oC). The column was removed from the collection tube and placed in a new collection tube. A 500μl of AW1 buffer was then added to the column and centrifuged (10,000xg, 1 min at 25oC). The column was removed from collection tube and it was then placed in new collection tube. A 500μl of AW2 buffer was then added to the column and centrifuged (20,000xg, 3 min at 25oC). The tubes were carefully removed from centrifuge. The column was then transferred to a 1.5ml tube and 200μl of AE buffer was added to the column. The column was stood at a room temperature for 1 min. Finally, the column was centrifuged (10,000xg, 1 min at 25oC) and non DNA parts were discarded and the DNA solution was appropriately stored at -20ºC until used for further analysis.
PCR for amplification of antibiotic resistance
Genomic DNA of Staphylococcus species isolates were subjected to PCR in order to amplify the resistance genes using PCR master kit with 25μl mixtures including 2μl of each primer, 1.5μl of 25mM of MgCl2, 5μl of PCR buffer, 0.5μl of dNTP, 0.5μl of Taq polymerase enzyme, 11.5μl of RNase free water and 2μl of extracted DNA. Sterile water was added instead of nucleic acids for the negative control. ATCC 25923T was used as positive control for all selected primers. The PCR tubes containing the mixture was tapped gently and the PCR tubes with all the components was transferred to (Flex cycler, Biometra Gmbh, Germany) thermal cycler. Three sets of primers were used for amplification of targeting antibiotic resistance genes. These genes are including such as (mecA, nuc and blaZ gene. These primers were commercially synthesized by Eurofins genomics India Pvt. Ltd. Oligonucleotide primers mecA-F (gtagaaatgactgaacgtccgatga) and mecA-R (ccaattccacattgtttcggtctaa) were used to target oxacillin resistant genes [21]. The mecA PCR program was included denaturation at 95°C for five minutes followed by (37) cycles at 95°C for 30s, 55°C for 30s, 72°C for 60s and a final extension at 72°C for 10 min were completed the amplification according to Salisbury et al. [37]. In this study, oligonucleotide primer nuc-F (gcgattgatggtgatacggtt) and nuc-R (agccaagccttgacgaactaaagc) were used to detect methicillin resistance gene. The nuc amplification was performed under the following condition: One cycle for initial denaturation 95°C for 5 min, 37cycles of 95oC for 30s, 55oC for 30s, and 72°C for 1min, 1 cycle of 72oC for 10min. Oligonucleotide primer blaZ was used to the detection of penicillin resistance gene. Forward (blaZ-F: tacaactgtaatatcggaggg) and Reverse (blaZ-R: cattacactcttggcggtttc) primers used for amplification of blaZ gene for staphylococcus isolates was obtained from Okiki et al. [24]. The blaZ amplification program was performed under the following conditions: Initial denaturation 95°C for 5min, 37 cycles of 95°C for 30s, 55°C for 30s, 72°C for one minute with a final extension of 72°C for 10min.
Agarose gel electrophoresis and visualization
The PCR products were separated on 1.5% (w/v) agarose gel containing ethidium bromide (2µl) that intercalate into the DNA and used for visualization. A 8μl amplification product of each samples with 2μl of DNA loading dye (3µl) was applied into the slots of agarose gel. DNA marker of 100bp (Qiagen; Germany) was used to estimate molecular weight of the DNA fragments. Electrophoresis (Apelex Midigel XL, France) was performed in Tris-Borate Ethylene Diamine Tetra Acetic Acid (1X TBE) buffer at 100v for one hour. The products were visualized with UV illumination (Gel DocTM XR+, BioRAD; Germany) and imaged with gel documentation system.PCR amplification for 16S rDNA gene for isolate identification
The isolates that have a resistance gene in the selected primer was selected for 16S гDNA sequencing studies. The genomic DNA of the isolates was extracted using Quick-DNA™ Fungal/Bacterial Miniprep Kit Catalog No. D6005 from Zymo Research. About 109 (50–100mg) wet weight of bacterial cells that have been re-suspended in up to 200µl of isotonic buffer was added to a ZR BashingBead™ Lysis Tube (0.1mm & 0.5mm). 750µl BashingBead™ Buffer was added to the cap tubes that prevent leakage. Bead beater fitted with a 2 ml tube holder assembly was secured and centrifugation at maximum speed for ≥ 5 minutes was processed. The ZR BashingBead™ Lysis Tube (0.1 & 0.5mm) in a micro centrifuge was centrifuged (10,000xg, 1min at 25oC). Up to 400µl of supernatant was transferred to a Zymo-Spin™ III-F filter in a collection tube and centrifuged (8,000xg,1 min at 25oC). 1,200µl of genomic lysis buffer was added to the filtrate in the collection tube from step 4. Transfer 800 µl of the mixture was transferred from Step 5 to a Zymo-Spin™ IICR Column in a collection tube and centrifuged (10,000xg, 1 min at 25oC ). The flow through from the Collection Tube was discarded and the Step 6 was repeated. 200µl DNA Pre-Wash Buffer was added to the Zymo-Spin™ IICR column in a new collection tube and centrifuged (10,000xg, 1 min at 25oC). A 500µl g-DNA Wash Buffer was added to the Zymo-Spin™ IICR Column and centrifuged (10,000xg, 1 min at 25oC). The Zymo-Spin™ IICR Column was transferred to a clean 1.5ml micro centrifuge tube and 50µl DNA elution buffer was directly added to the column matrix and centrifuge (10,000xg, 30s at 25oC) to elute the DNA.
The concentration of each DNA sample was measured by Nano drop (Biotech instruments, USA). DNA was stored at -80oC for further use. The ratio of absorbance at 260 nm and 280 nm is used to assess the purity of DNA. A ratio of ~1.8 to 2.0 is generally accepted as pure for DNA analysis. If the ratio is appreciably lower in either case, it may indicate the presence of protein, phenol or other contaminants that absorb strongly at or near 280 nm.
PCR was performed in a total volume of 25μl containing 10pmol each of forward (27F- agagtttgatcctggctcag) and reverse (1492R-tacggttaccttgttacgactt) primers, 2.5mM of MgCl2, 200μM each of the four deoxy ribonucleotide triphosphates (dNTPs), 0.5 U of Taq DNA polymerase, 1x concentration of PCR buffer (Invitrogen, Life Technologies, Brazil) and 50 to 100ng of isolated bacterial genomic DNA. The template was denatured by heating at pre-denaturation of 95°C for 5min. This was followed by 39 cycles of denaturation 30s at 95 °C, 45s annealing and 1min elongation at 72°C, with a final extension of 7 min at 72°C. The amplicons were resolved in 1.5% agarose gel using 0.5x tris-acetate-EDTA (TAE) buffer at 50V for 30 to 45min till DNA fragments are migrated across gell. The gel was photographed on gel documentation system.
The sequencing of the purified 16srRNA gene of PCR product was performed by Sanger sequencer method (ABI 3730XL). The generated sequence was submitted for a Basic Local Alignment Search Tool (BLAST) in the NCBI GenBank database [38]. The sequence with the highest homology with a maximum query coverage and maximum score was used to ascertain the identity of the Staphylococcus species [39].
Phylogenetic tree analysis
The 16S rDNA gene sequences were analyzed with Basic Local Alignment Search Tool (BLAST) program available on the National Center for Biotechnology Information (NCBI). The 16SrRNA gene sequences were extracted from the genomic DNA of strains these showing sequence similarity more than 99% with recent our isolate (PSSI-D8) after blasting it using tools that available at http://www.ncbi.nlm.nih.gov/blast. The 16SrRNA gene sequence for PSSI-D8 was submitted to to the NCBI GenBank database with the accession numbers ON597423.1. The 16S rDNA genes sequence that similar to newly isolated bacterial species were also collected from GenBank database using EzTaxon server (https://www.ezbiocloud.net/identify). These strains were aligned by multiple sequence alignment program (Align by Muscle, codons) and phylogenetic tree was performed with the MEGA version 11 software package [40]. The related sequences for phylogenetic tree analysis were obtained from NCBI database using NCBI-BLAST tools in which the sequence similarity of isolate is about 99.47% identity. Phylogenetic tree was performed for aligned sequence and evolutionary distances were done by using Maximum likelihood statistical method and Kimura two parameter distance model at Has Invariant sites with the Gap or missing data treatment as partial deletion [41]. Confidence values were estimated from bootstrap analyses of 1,000 times [42]. Erwinia tasmaniensis Et199 (T) (HG522775.1) was designated as out-group for phylogenetic tree to be constructed.
Data management and analysis
Data were computed in Microsoft Excel to calculate the mean, standard deviation, and standard error for isolated biomass (CDW, g/ml) against different carbon sources, and physical parameters such as pH and temperatures. IBM SPSS Statistics 20 and OriginPro8.5 statistical software were used for data analysis. All data were the mean of experiments performed in triplicate. Descriptive statistics were used to summarize quantitative data.